Incidental Mutation 'R9398:Cntnap3'
ID 710961
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R9398 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 64736182-64903955 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 64903834 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 3 (R3W)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect probably benign
Transcript: ENSMUST00000091554
AA Change: R3W

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: R3W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,137,043 K228* probably null Het
Adrb2 T C 18: 62,179,205 D183G probably benign Het
Ap1m2 A G 9: 21,305,639 Y134H probably damaging Het
Arid5a A G 1: 36,318,992 T217A probably benign Het
Cdnf C T 2: 3,521,038 T89I possibly damaging Het
Col6a6 A G 9: 105,774,626 I1062T probably benign Het
Ctss T C 3: 95,546,947 F270S possibly damaging Het
Ddhd1 C T 14: 45,657,660 G118R possibly damaging Het
Ddx11 A G 17: 66,129,917 K69E probably benign Het
Dgkb G A 12: 38,139,658 G328D probably damaging Het
Dock1 C T 7: 135,172,499 T1852M probably damaging Het
Gm19410 T C 8: 35,805,202 Y1346H probably benign Het
Gm6614 A G 6: 141,994,785 S137P possibly damaging Het
Gprin1 G T 13: 54,739,570 T297N probably damaging Het
Gramd1c A G 16: 44,013,018 F187S probably damaging Het
Gse1 A G 8: 120,576,335 N1072D unknown Het
Gtf3c6 G A 10: 40,257,524 probably benign Het
Hipk3 T A 2: 104,433,217 T897S probably benign Het
Igsf21 T A 4: 140,246,451 probably benign Het
Itgb1 A G 8: 128,726,124 I757V probably damaging Het
Lamb2 C T 9: 108,487,167 R1102W possibly damaging Het
Lzts2 T G 19: 45,024,769 C374W unknown Het
Mapk10 A T 5: 102,913,286 S462T probably damaging Het
Mtcl1 A T 17: 66,448,467 D293E possibly damaging Het
Nf1 T G 11: 79,547,192 H109Q probably damaging Het
Nlrp9b T C 7: 20,049,510 L926P probably damaging Het
Notch2 G A 3: 98,102,352 D532N probably damaging Het
Olfm4 A T 14: 80,011,809 Y122F probably benign Het
Olfr1001-ps1 T C 2: 85,634,023 V198A probably benign Het
Olfr141 A G 2: 86,806,816 L61P possibly damaging Het
Olfr502 T C 7: 108,523,828 T41A probably damaging Het
Olfr569 A G 7: 102,887,793 M120T probably damaging Het
Olfr603 T A 7: 103,383,280 T241S probably damaging Het
Olfr684 A T 7: 105,156,799 Y294* probably null Het
P2rx2 A T 5: 110,340,272 M472K probably benign Het
Pbxip1 A G 3: 89,447,634 K487E probably benign Het
Plxnb2 A G 15: 89,160,919 V1108A probably benign Het
Polq A G 16: 37,061,032 N1186S probably benign Het
Por T A 5: 135,725,743 W6R unknown Het
Prex2 G A 1: 11,136,804 V529I probably benign Het
Rgs6 T G 12: 82,651,841 S5A probably benign Het
Rp9 G T 9: 22,448,786 S171* probably null Het
Sec11c T A 18: 65,809,497 I47N possibly damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GACCAGCTCAGCCACGGG GACCAGCTCAGCCACGGGTACCAGCTCAGCCACGGG 7: 126,467,574 probably benign Het
Sh2b1 GCCACGGGGACCAGCTC GCCACGGGGACCAGCTCATCCACGGGGACCAGCTC 7: 126,467,584 probably benign Het
Sorcs1 A G 19: 50,225,213 M692T possibly damaging Het
Sult1d1 T A 5: 87,566,095 Q30L probably benign Het
Tcea2 A G 2: 181,680,450 D15G probably damaging Het
Tep1 T C 14: 50,828,972 S2344G possibly damaging Het
Ttc6 T A 12: 57,737,618 Y1824* probably null Het
Ubqln5 T C 7: 104,128,778 T280A probably benign Het
Ush1c T C 7: 46,220,510 R342G probably benign Het
Vmn1r185 T A 7: 26,611,631 I150F probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn1r86 A G 7: 13,102,334 M205T probably damaging Het
Vps13d A T 4: 145,170,386 Y321* probably null Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64772777 nonsense probably null
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64787867 missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64738665 missense probably benign 0.31
R8491:Cntnap3 UTSW 13 64785343 missense probably damaging 1.00
R9086:Cntnap3 UTSW 13 64781759 missense probably damaging 1.00
R9087:Cntnap3 UTSW 13 64751718 missense probably damaging 0.96
R9475:Cntnap3 UTSW 13 64799135 missense probably damaging 1.00
Z1176:Cntnap3 UTSW 13 64740872 frame shift probably null
Z1176:Cntnap3 UTSW 13 64792388 missense probably damaging 0.98
Z1177:Cntnap3 UTSW 13 64781892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGGTTGCAACTGAATAGGG -3'
(R):5'- ATTGTGTGCAGCTGGAGCAG -3'

Sequencing Primer
(F):5'- GAAACCCCATTTTTATTTTTCACCAG -3'
(R):5'- GCAGAGGCTCTGGCTTC -3'
Posted On 2022-04-18