Incidental Mutation 'R9398:Sorcs1'
ID 710974
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R9398 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 50131737-50667084 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50213651 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 692 (M692T)
Ref Sequence ENSEMBL: ENSMUSP00000147463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000072685
AA Change: M692T

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: M692T

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111756
AA Change: M692T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: M692T

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164039
AA Change: M692T

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: M692T

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209413
AA Change: M692T

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209783
AA Change: M692T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211008
AA Change: M692T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211687
AA Change: M692T

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,034,924 (GRCm39) K228* probably null Het
Adrb2 T C 18: 62,312,276 (GRCm39) D183G probably benign Het
Ap1m2 A G 9: 21,216,935 (GRCm39) Y134H probably damaging Het
Arid5a A G 1: 36,358,073 (GRCm39) T217A probably benign Het
Cdnf C T 2: 3,522,075 (GRCm39) T89I possibly damaging Het
Cntnap3 G A 13: 65,051,648 (GRCm39) R3W probably benign Het
Col6a6 A G 9: 105,651,825 (GRCm39) I1062T probably benign Het
Ctss T C 3: 95,454,258 (GRCm39) F270S possibly damaging Het
Ddhd1 C T 14: 45,895,117 (GRCm39) G118R possibly damaging Het
Ddx11 A G 17: 66,436,912 (GRCm39) K69E probably benign Het
Dgkb G A 12: 38,189,657 (GRCm39) G328D probably damaging Het
Dock1 C T 7: 134,774,228 (GRCm39) T1852M probably damaging Het
Gm19410 T C 8: 36,272,356 (GRCm39) Y1346H probably benign Het
Gprin1 G T 13: 54,887,383 (GRCm39) T297N probably damaging Het
Gramd1c A G 16: 43,833,381 (GRCm39) F187S probably damaging Het
Gse1 A G 8: 121,303,074 (GRCm39) N1072D unknown Het
Gtf3c6 G A 10: 40,133,520 (GRCm39) probably benign Het
Hipk3 T A 2: 104,263,562 (GRCm39) T897S probably benign Het
Igsf21 T A 4: 139,973,762 (GRCm39) probably benign Het
Itgb1 A G 8: 129,452,605 (GRCm39) I757V probably damaging Het
Lamb2 C T 9: 108,364,366 (GRCm39) R1102W possibly damaging Het
Lzts2 T G 19: 45,013,208 (GRCm39) C374W unknown Het
Mapk10 A T 5: 103,061,152 (GRCm39) S462T probably damaging Het
Mtcl1 A T 17: 66,755,462 (GRCm39) D293E possibly damaging Het
Nf1 T G 11: 79,438,018 (GRCm39) H109Q probably damaging Het
Nlrp9b T C 7: 19,783,435 (GRCm39) L926P probably damaging Het
Notch2 G A 3: 98,009,668 (GRCm39) D532N probably damaging Het
Olfm4 A T 14: 80,249,249 (GRCm39) Y122F probably benign Het
Or52e19b T A 7: 103,032,487 (GRCm39) T241S probably damaging Het
Or52r1 A G 7: 102,537,000 (GRCm39) M120T probably damaging Het
Or56a4 A T 7: 104,806,006 (GRCm39) Y294* probably null Het
Or5g24-ps1 T C 2: 85,464,367 (GRCm39) V198A probably benign Het
Or5p76 T C 7: 108,123,035 (GRCm39) T41A probably damaging Het
Or5t18 A G 2: 86,637,160 (GRCm39) L61P possibly damaging Het
P2rx2 A T 5: 110,488,138 (GRCm39) M472K probably benign Het
Pbxip1 A G 3: 89,354,941 (GRCm39) K487E probably benign Het
Plxnb2 A G 15: 89,045,122 (GRCm39) V1108A probably benign Het
Polq A G 16: 36,881,394 (GRCm39) N1186S probably benign Het
Por T A 5: 135,754,597 (GRCm39) W6R unknown Het
Prex2 G A 1: 11,207,028 (GRCm39) V529I probably benign Het
Rgs6 T G 12: 82,698,615 (GRCm39) S5A probably benign Het
Rp9 G T 9: 22,360,082 (GRCm39) S171* probably null Het
Sec11c T A 18: 65,942,568 (GRCm39) I47N possibly damaging Het
Sh2b1 GCCACGGGGACCAGCTC GCCACGGGGACCAGCTCATCCACGGGGACCAGCTC 7: 126,066,756 (GRCm39) probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Sh2b1 GACCAGCTCAGCCACGGG GACCAGCTCAGCCACGGGTACCAGCTCAGCCACGGG 7: 126,066,746 (GRCm39) probably benign Het
Slco1a8 A G 6: 141,940,511 (GRCm39) S137P possibly damaging Het
Sult1d1 T A 5: 87,713,954 (GRCm39) Q30L probably benign Het
Tcea2 A G 2: 181,322,243 (GRCm39) D15G probably damaging Het
Tep1 T C 14: 51,066,429 (GRCm39) S2344G possibly damaging Het
Ttc6 T A 12: 57,784,404 (GRCm39) Y1824* probably null Het
Ubqln5 T C 7: 103,777,985 (GRCm39) T280A probably benign Het
Ush1c T C 7: 45,869,934 (GRCm39) R342G probably benign Het
Vmn1r185 T A 7: 26,311,056 (GRCm39) I150F probably benign Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vmn1r86 A G 7: 12,836,261 (GRCm39) M205T probably damaging Het
Vps13d A T 4: 144,896,956 (GRCm39) Y321* probably null Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50,178,492 (GRCm39) missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50,164,566 (GRCm39) missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50,216,639 (GRCm39) missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50,276,517 (GRCm39) splice site probably benign
IGL01445:Sorcs1 APN 19 50,141,504 (GRCm39) missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50,169,944 (GRCm39) missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50,218,647 (GRCm39) critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50,276,597 (GRCm39) splice site probably benign
IGL02111:Sorcs1 APN 19 50,218,683 (GRCm39) missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50,322,036 (GRCm39) missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50,171,109 (GRCm39) nonsense probably null
IGL02498:Sorcs1 APN 19 50,666,606 (GRCm39) missense probably benign
IGL02658:Sorcs1 APN 19 50,178,530 (GRCm39) missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50,666,368 (GRCm39) nonsense probably null
IGL02942:Sorcs1 APN 19 50,463,875 (GRCm39) missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50,248,194 (GRCm39) nonsense probably null
IGL03230:Sorcs1 APN 19 50,230,531 (GRCm39) missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50,141,345 (GRCm39) missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50,367,329 (GRCm39) splice site probably benign
R0115:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50,301,480 (GRCm39) splice site probably null
R0481:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0581:Sorcs1 UTSW 19 50,241,139 (GRCm39) missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50,230,380 (GRCm39) splice site probably benign
R0980:Sorcs1 UTSW 19 50,220,761 (GRCm39) missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50,132,598 (GRCm39) unclassified probably benign
R1519:Sorcs1 UTSW 19 50,241,025 (GRCm39) missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50,463,860 (GRCm39) missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50,163,481 (GRCm39) splice site probably benign
R1783:Sorcs1 UTSW 19 50,216,747 (GRCm39) critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50,210,633 (GRCm39) missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50,666,630 (GRCm39) missense probably benign
R2206:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50,199,088 (GRCm39) missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50,139,659 (GRCm39) missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50,210,597 (GRCm39) missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50,178,599 (GRCm39) missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50,367,379 (GRCm39) missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50,301,402 (GRCm39) critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50,171,107 (GRCm39) missense probably benign
R4780:Sorcs1 UTSW 19 50,132,419 (GRCm39) unclassified probably benign
R4781:Sorcs1 UTSW 19 50,171,119 (GRCm39) missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50,218,740 (GRCm39) missense possibly damaging 0.87
R4823:Sorcs1 UTSW 19 50,666,578 (GRCm39) missense possibly damaging 0.92
R4883:Sorcs1 UTSW 19 50,220,741 (GRCm39) missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50,213,579 (GRCm39) missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50,241,040 (GRCm39) missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50,210,571 (GRCm39) missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50,171,213 (GRCm39) missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50,178,555 (GRCm39) nonsense probably null
R6091:Sorcs1 UTSW 19 50,276,539 (GRCm39) missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50,276,532 (GRCm39) missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50,169,852 (GRCm39) missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50,132,562 (GRCm39) missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50,213,615 (GRCm39) missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50,164,560 (GRCm39) nonsense probably null
R6792:Sorcs1 UTSW 19 50,666,606 (GRCm39) missense probably benign
R6891:Sorcs1 UTSW 19 50,213,557 (GRCm39) nonsense probably null
R7151:Sorcs1 UTSW 19 50,301,420 (GRCm39) missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50,178,480 (GRCm39) missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50,163,595 (GRCm39) missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50,250,701 (GRCm39) missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50,141,550 (GRCm39) missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50,141,490 (GRCm39) missense probably benign
R7506:Sorcs1 UTSW 19 50,171,112 (GRCm39) nonsense probably null
R7573:Sorcs1 UTSW 19 50,141,234 (GRCm39) nonsense probably null
R7867:Sorcs1 UTSW 19 50,218,698 (GRCm39) nonsense probably null
R7911:Sorcs1 UTSW 19 50,132,470 (GRCm39) missense unknown
R8032:Sorcs1 UTSW 19 50,463,846 (GRCm39) missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50,132,415 (GRCm39) missense unknown
R8463:Sorcs1 UTSW 19 50,248,248 (GRCm39) missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50,367,398 (GRCm39) missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50,139,658 (GRCm39) missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50,241,096 (GRCm39) missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50,213,658 (GRCm39) missense probably damaging 1.00
R9173:Sorcs1 UTSW 19 50,220,753 (GRCm39) missense possibly damaging 0.92
R9203:Sorcs1 UTSW 19 50,250,733 (GRCm39) missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50,141,300 (GRCm39) missense probably benign 0.17
R9430:Sorcs1 UTSW 19 50,199,208 (GRCm39) missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50,215,275 (GRCm39) missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50,171,201 (GRCm39) missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50,210,581 (GRCm39) missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50,322,037 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs1 UTSW 19 50,215,180 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATTCAGGGCTTCACAGATGTC -3'
(R):5'- AGGATAGCCACATTCCGTGTC -3'

Sequencing Primer
(F):5'- CAGGGCTTCACAGATGTCATATTAG -3'
(R):5'- GTGTTCATACTTCATATTAGGCGTC -3'
Posted On 2022-04-18