Incidental Mutation 'R9400:Slc9a2'
ID 711026
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms 2210416H12Rik, 4932415O19Rik, NHE2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R9400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 40680574-40769273 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40719051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 250 (V250A)
Ref Sequence ENSEMBL: ENSMUSP00000027231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]
AlphaFold Q3ZAS0
Predicted Effect possibly damaging
Transcript: ENSMUST00000027231
AA Change: V250A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: V250A

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000192345
AA Change: V250A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: V250A

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 336 2.5e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 8,992,286 N89S probably benign Het
9930111J21Rik1 C T 11: 48,948,417 E448K possibly damaging Het
Acer1 G A 17: 56,981,990 T40M probably damaging Het
Adam1a T C 5: 121,519,830 T467A probably benign Het
Agmat A G 4: 141,749,670 D129G probably damaging Het
Ak8 T A 2: 28,759,999 I346N probably benign Het
Ankrd12 A T 17: 65,984,880 V1186E probably damaging Het
Ankrd27 T G 7: 35,616,857 L516R probably damaging Het
Aplp2 C A 9: 31,164,559 R402L possibly damaging Het
Aspm A G 1: 139,479,903 Y2176C probably damaging Het
Boc T C 16: 44,499,481 D380G Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Chst2 T C 9: 95,405,589 S235G probably benign Het
Clca4b A G 3: 144,911,192 V899A probably benign Het
Ddx1 A G 12: 13,223,702 S617P probably damaging Het
Etv5 A T 16: 22,401,726 F304I probably benign Het
Fmo9 T G 1: 166,677,674 E50A probably benign Het
Gbp11 T C 5: 105,330,975 E199G probably damaging Het
Gemin5 C T 11: 58,137,715 G893D probably damaging Het
Gorab G T 1: 163,396,998 P78Q probably damaging Het
Gprc5a A G 6: 135,078,560 T2A probably benign Het
Gtf3c1 A G 7: 125,676,511 I581T probably damaging Het
H6pd A G 4: 149,995,791 F199S probably damaging Het
Hdac3 A T 18: 37,937,624 V426E possibly damaging Het
Jag2 G T 12: 112,911,988 Y838* probably null Het
Kat6b G T 14: 21,609,758 R210L probably damaging Het
Kctd11 C A 11: 69,879,718 E165* probably null Het
Knl1 T C 2: 119,100,743 V1980A probably damaging Het
Lilr4b T C 10: 51,481,223 S52P probably benign Het
Lrp5 T G 19: 3,585,272 M1535L probably benign Het
Lrr1 A G 12: 69,174,702 D206G probably benign Het
Lrrd1 G A 5: 3,849,677 probably benign Het
Map3k6 C A 4: 133,241,156 A23E probably damaging Het
Mgat4a T C 1: 37,462,944 D241G probably damaging Het
Mpzl3 A G 9: 45,074,779 Y237C possibly damaging Het
Mroh1 A G 15: 76,451,893 E1489G possibly damaging Het
Myocd T C 11: 65,196,108 H331R probably benign Het
Myoz1 T A 14: 20,649,436 H278L probably benign Het
Olfr102 A T 17: 37,313,663 C240* probably null Het
Olfr1199 A G 2: 88,755,949 I242T possibly damaging Het
Olfr1441 C A 19: 12,422,910 N200K possibly damaging Het
Olfr1449 T A 19: 12,935,514 Y259N probably damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr381 A T 11: 73,485,981 V281E probably damaging Het
Otof A T 5: 30,383,519 probably null Het
Pcdha1 A G 18: 36,931,707 I475V probably benign Het
Pcgf1 A G 6: 83,080,085 E199G possibly damaging Het
Pip C A 6: 41,851,848 T109K probably benign Het
Slc12a7 A G 13: 73,784,570 E59G probably benign Het
Slc38a2 T C 15: 96,693,172 I237V probably benign Het
Slc6a5 T C 7: 49,945,519 V543A probably benign Het
Smarcad1 T C 6: 65,073,230 Y278H probably damaging Het
Snx7 A T 3: 117,837,214 N248K probably benign Het
Spata6 T A 4: 111,720,231 C9S probably benign Het
Stra6l T A 4: 45,885,293 L587Q probably damaging Het
Tmem131l G T 3: 83,922,986 N916K possibly damaging Het
Tmprss11c C T 5: 86,237,657 V319I probably benign Het
Tpo A T 12: 30,119,442 I98K possibly damaging Het
Umodl1 A G 17: 30,996,393 T1064A probably damaging Het
Vldlr T C 19: 27,238,775 I332T probably damaging Het
Wdr75 T A 1: 45,803,904 L133Q probably damaging Het
Zdhhc21 T C 4: 82,835,450 N167S probably benign Het
Zfp37 A T 4: 62,191,667 C428S probably damaging Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40767737 missense probably benign
IGL00487:Slc9a2 APN 1 40742658 missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40763583 missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40718810 missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40756293 missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40742669 missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40763602 missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40742703 missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40756271 missense probably benign 0.00
putty UTSW 1 40742653 nonsense probably null
E0370:Slc9a2 UTSW 1 40763541 critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40743841 missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40742804 missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40743857 missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40719018 missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40726388 missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40763610 missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40742643 missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40726437 missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40742768 missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40742608 splice site probably null
R3612:Slc9a2 UTSW 1 40719058 splice site probably null
R4631:Slc9a2 UTSW 1 40761918 missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40761916 missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40718849 missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40755718 missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40743893 missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40682036 missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40742653 nonsense probably null
R6453:Slc9a2 UTSW 1 40742621 missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40718909 missense probably damaging 0.99
R7088:Slc9a2 UTSW 1 40726379 missense probably damaging 1.00
R7302:Slc9a2 UTSW 1 40767668 missense possibly damaging 0.58
R7450:Slc9a2 UTSW 1 40681835 start gained probably benign
R7670:Slc9a2 UTSW 1 40718997 missense probably damaging 1.00
R7970:Slc9a2 UTSW 1 40726214 missense probably damaging 0.98
R8104:Slc9a2 UTSW 1 40718649 missense probably damaging 1.00
R8776:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
R8776-TAIL:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
R8887:Slc9a2 UTSW 1 40718849 missense probably benign 0.01
R9028:Slc9a2 UTSW 1 40726452 missense probably damaging 1.00
R9189:Slc9a2 UTSW 1 40755784 missense probably benign 0.21
R9245:Slc9a2 UTSW 1 40766300 missense probably benign 0.27
R9250:Slc9a2 UTSW 1 40767827 missense probably benign 0.00
R9512:Slc9a2 UTSW 1 40682098 missense probably damaging 0.98
X0054:Slc9a2 UTSW 1 40742687 missense probably damaging 0.99
Z1176:Slc9a2 UTSW 1 40767711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGATTGAGGCGTTTGGC -3'
(R):5'- TTTCAAGATCACATCATAAGCTCAC -3'

Sequencing Primer
(F):5'- GTTTGGCCTCAGTGACATCAC -3'
(R):5'- TCCAGCAAGATGTGATCTGC -3'
Posted On 2022-04-20