Mutagenetix > Incidental Mutation

Incidental Mutation 'R9400:Slc9a2'

711026

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R9400 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40719051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 250 (V250A)

Ref Sequence

ENSEMBL: ENSMUSP00000027231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]

AlphaFold

Q3ZAS0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027231
AA Change: V250A

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: V250A

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192345
AA Change: V250A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: V250A

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	336	2.5e-56	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	A	G	17: 8,992,286	N89S	probably benign	Het
9930111J21Rik1	C	T	11: 48,948,417	E448K	possibly damaging	Het
Acer1	G	A	17: 56,981,990	T40M	probably damaging	Het
Adam1a	T	C	5: 121,519,830	T467A	probably benign	Het
Agmat	A	G	4: 141,749,670	D129G	probably damaging	Het
Ak8	T	A	2: 28,759,999	I346N	probably benign	Het
Ankrd12	A	T	17: 65,984,880	V1186E	probably damaging	Het
Ankrd27	T	G	7: 35,616,857	L516R	probably damaging	Het
Aplp2	C	A	9: 31,164,559	R402L	possibly damaging	Het
Aspm	A	G	1: 139,479,903	Y2176C	probably damaging	Het
Boc	T	C	16: 44,499,481	D380G		Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Chst2	T	C	9: 95,405,589	S235G	probably benign	Het
Clca4b	A	G	3: 144,911,192	V899A	probably benign	Het
Ddx1	A	G	12: 13,223,702	S617P	probably damaging	Het
Etv5	A	T	16: 22,401,726	F304I	probably benign	Het
Fmo9	T	G	1: 166,677,674	E50A	probably benign	Het
Gbp11	T	C	5: 105,330,975	E199G	probably damaging	Het
Gemin5	C	T	11: 58,137,715	G893D	probably damaging	Het
Gorab	G	T	1: 163,396,998	P78Q	probably damaging	Het
Gprc5a	A	G	6: 135,078,560	T2A	probably benign	Het
Gtf3c1	A	G	7: 125,676,511	I581T	probably damaging	Het
H6pd	A	G	4: 149,995,791	F199S	probably damaging	Het
Hdac3	A	T	18: 37,937,624	V426E	possibly damaging	Het
Jag2	G	T	12: 112,911,988	Y838*	probably null	Het
Kat6b	G	T	14: 21,609,758	R210L	probably damaging	Het
Kctd11	C	A	11: 69,879,718	E165*	probably null	Het
Knl1	T	C	2: 119,100,743	V1980A	probably damaging	Het
Lilr4b	T	C	10: 51,481,223	S52P	probably benign	Het
Lrp5	T	G	19: 3,585,272	M1535L	probably benign	Het
Lrr1	A	G	12: 69,174,702	D206G	probably benign	Het
Lrrd1	G	A	5: 3,849,677		probably benign	Het
Map3k6	C	A	4: 133,241,156	A23E	probably damaging	Het
Mgat4a	T	C	1: 37,462,944	D241G	probably damaging	Het
Mpzl3	A	G	9: 45,074,779	Y237C	possibly damaging	Het
Mroh1	A	G	15: 76,451,893	E1489G	possibly damaging	Het
Myocd	T	C	11: 65,196,108	H331R	probably benign	Het
Myoz1	T	A	14: 20,649,436	H278L	probably benign	Het
Olfr102	A	T	17: 37,313,663	C240*	probably null	Het
Olfr1199	A	G	2: 88,755,949	I242T	possibly damaging	Het
Olfr1441	C	A	19: 12,422,910	N200K	possibly damaging	Het
Olfr1449	T	A	19: 12,935,514	Y259N	probably damaging	Het
Olfr1454	T	A	19: 13,063,775	Y121*	probably null	Het
Olfr381	A	T	11: 73,485,981	V281E	probably damaging	Het
Otof	A	T	5: 30,383,519		probably null	Het
Pcdha1	A	G	18: 36,931,707	I475V	probably benign	Het
Pcgf1	A	G	6: 83,080,085	E199G	possibly damaging	Het
Pip	C	A	6: 41,851,848	T109K	probably benign	Het
Slc12a7	A	G	13: 73,784,570	E59G	probably benign	Het
Slc38a2	T	C	15: 96,693,172	I237V	probably benign	Het
Slc6a5	T	C	7: 49,945,519	V543A	probably benign	Het
Smarcad1	T	C	6: 65,073,230	Y278H	probably damaging	Het
Snx7	A	T	3: 117,837,214	N248K	probably benign	Het
Spata6	T	A	4: 111,720,231	C9S	probably benign	Het
Stra6l	T	A	4: 45,885,293	L587Q	probably damaging	Het
Tmem131l	G	T	3: 83,922,986	N916K	possibly damaging	Het
Tmprss11c	C	T	5: 86,237,657	V319I	probably benign	Het
Tpo	A	T	12: 30,119,442	I98K	possibly damaging	Het
Umodl1	A	G	17: 30,996,393	T1064A	probably damaging	Het
Vldlr	T	C	19: 27,238,775	I332T	probably damaging	Het
Wdr75	T	A	1: 45,803,904	L133Q	probably damaging	Het
Zdhhc21	T	C	4: 82,835,450	N167S	probably benign	Het
Zfp37	A	T	4: 62,191,667	C428S	probably damaging	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
putty	UTSW	1	40742653	nonsense	probably null
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8887:Slc9a2	UTSW	1	40718849	missense	probably benign	0.01
R9028:Slc9a2	UTSW	1	40726452	missense	probably damaging	1.00
R9189:Slc9a2	UTSW	1	40755784	missense	probably benign	0.21
R9245:Slc9a2	UTSW	1	40766300	missense	probably benign	0.27
R9250:Slc9a2	UTSW	1	40767827	missense	probably benign	0.00
R9512:Slc9a2	UTSW	1	40682098	missense	probably damaging	0.98
R9583:Slc9a2	UTSW	1	40681901	missense	probably benign
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGATTGAGGCGTTTGGC -3'
(R):5'- TTTCAAGATCACATCATAAGCTCAC -3'

Sequencing Primer
(F):5'- GTTTGGCCTCAGTGACATCAC -3'
(R):5'- TCCAGCAAGATGTGATCTGC -3'

Posted On

2022-04-20