Incidental Mutation 'R9400:Aspm'
ID 711028
Institutional Source Beutler Lab
Gene Symbol Aspm
Ensembl Gene ENSMUSG00000033952
Gene Name abnormal spindle microtubule assembly
Synonyms Aspm, Sha1, MCPH5, D330028K02Rik, Calmbp1
Accession Numbers

Genbank: NM_009791; MGI: 1334448

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 139454772-139494091 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139479903 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 2176 (Y2176C)
Ref Sequence ENSEMBL: ENSMUSP00000059159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053364
AA Change: Y2176C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952
AA Change: Y2176C

DomainStartEndE-ValueType
Pfam:ASH 29 126 8.9e-35 PFAM
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 2.41e-4 SMART
IQ 1360 1382 2.12e1 SMART
IQ 1387 1408 7.61e1 SMART
IQ 1409 1431 6.97e0 SMART
IQ 1432 1452 1.44e1 SMART
IQ 1453 1475 1.15e-1 SMART
IQ 1476 1495 1.66e2 SMART
IQ 1503 1525 1.65e-2 SMART
IQ 1526 1548 1.32e1 SMART
IQ 1549 1571 1.48e1 SMART
IQ 1572 1594 2.5e1 SMART
IQ 1599 1621 2.58e-4 SMART
IQ 1622 1644 6.7e-3 SMART
IQ 1645 1667 4.25e1 SMART
IQ 1668 1694 1.03e2 SMART
IQ 1695 1717 2.33e-2 SMART
IQ 1718 1740 7.79e0 SMART
IQ 1741 1763 1.57e2 SMART
IQ 1768 1790 2.68e-2 SMART
IQ 1791 1813 5.83e-3 SMART
IQ 1814 1836 5.93e1 SMART
IQ 1841 1863 1.92e-3 SMART
IQ 1864 1886 3.79e-2 SMART
IQ 1914 1936 4.11e0 SMART
IQ 1937 1959 1.87e-1 SMART
IQ 1960 1982 6.27e1 SMART
IQ 1987 2009 8.25e-3 SMART
IQ 2010 2032 5.73e0 SMART
IQ 2060 2082 1.39e0 SMART
IQ 2083 2105 4.62e1 SMART
IQ 2133 2155 5.58e0 SMART
IQ 2156 2178 7.07e-2 SMART
IQ 2206 2228 1.18e-3 SMART
IQ 2229 2251 4.59e0 SMART
IQ 2278 2300 1.85e-5 SMART
IQ 2301 2323 8.13e-2 SMART
IQ 2342 2364 9.62e-4 SMART
IQ 2365 2387 4.12e-3 SMART
IQ 2415 2437 7.58e-2 SMART
IQ 2438 2460 2.6e0 SMART
IQ 2490 2512 1.68e-3 SMART
IQ 2513 2535 8.51e1 SMART
IQ 2560 2582 2.14e-1 SMART
IQ 2601 2623 8.46e0 SMART
IQ 2647 2669 1.15e1 SMART
IQ 2673 2695 1.95e-4 SMART
IQ 2696 2718 4.13e1 SMART
IQ 2723 2745 1.02e-2 SMART
IQ 2761 2783 3.14e2 SMART
IQ 2784 2806 1e1 SMART
IQ 2825 2847 2.43e0 SMART
IQ 2848 2870 4.6e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200083
SMART Domains Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952

DomainStartEndE-ValueType
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 1.25e1 SMART
IQ 1337 1358 2.96e1 SMART
IQ 1382 1404 1.15e1 SMART
IQ 1408 1430 1.95e-4 SMART
IQ 1431 1453 4.13e1 SMART
IQ 1458 1480 1.02e-2 SMART
IQ 1496 1518 3.14e2 SMART
IQ 1519 1541 1e1 SMART
IQ 1560 1582 2.43e0 SMART
IQ 1583 1605 4.6e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 8,992,286 N89S probably benign Het
9930111J21Rik1 C T 11: 48,948,417 E448K possibly damaging Het
Acer1 G A 17: 56,981,990 T40M probably damaging Het
Adam1a T C 5: 121,519,830 T467A probably benign Het
Agmat A G 4: 141,749,670 D129G probably damaging Het
Ak8 T A 2: 28,759,999 I346N probably benign Het
Ankrd12 A T 17: 65,984,880 V1186E probably damaging Het
Ankrd27 T G 7: 35,616,857 L516R probably damaging Het
Aplp2 C A 9: 31,164,559 R402L possibly damaging Het
Boc T C 16: 44,499,481 D380G Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Chst2 T C 9: 95,405,589 S235G probably benign Het
Clca4b A G 3: 144,911,192 V899A probably benign Het
Ddx1 A G 12: 13,223,702 S617P probably damaging Het
Etv5 A T 16: 22,401,726 F304I probably benign Het
Fmo9 T G 1: 166,677,674 E50A probably benign Het
Gbp11 T C 5: 105,330,975 E199G probably damaging Het
Gemin5 C T 11: 58,137,715 G893D probably damaging Het
Gorab G T 1: 163,396,998 P78Q probably damaging Het
Gprc5a A G 6: 135,078,560 T2A probably benign Het
Gtf3c1 A G 7: 125,676,511 I581T probably damaging Het
H6pd A G 4: 149,995,791 F199S probably damaging Het
Hdac3 A T 18: 37,937,624 V426E possibly damaging Het
Jag2 G T 12: 112,911,988 Y838* probably null Het
Kat6b G T 14: 21,609,758 R210L probably damaging Het
Kctd11 C A 11: 69,879,718 E165* probably null Het
Knl1 T C 2: 119,100,743 V1980A probably damaging Het
Lilr4b T C 10: 51,481,223 S52P probably benign Het
Lrp5 T G 19: 3,585,272 M1535L probably benign Het
Lrr1 A G 12: 69,174,702 D206G probably benign Het
Lrrd1 G A 5: 3,849,677 probably benign Het
Map3k6 C A 4: 133,241,156 A23E probably damaging Het
Mgat4a T C 1: 37,462,944 D241G probably damaging Het
Mpzl3 A G 9: 45,074,779 Y237C possibly damaging Het
Mroh1 A G 15: 76,451,893 E1489G possibly damaging Het
Myocd T C 11: 65,196,108 H331R probably benign Het
Myoz1 T A 14: 20,649,436 H278L probably benign Het
Olfr102 A T 17: 37,313,663 C240* probably null Het
Olfr1199 A G 2: 88,755,949 I242T possibly damaging Het
Olfr1441 C A 19: 12,422,910 N200K possibly damaging Het
Olfr1449 T A 19: 12,935,514 Y259N probably damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr381 A T 11: 73,485,981 V281E probably damaging Het
Otof A T 5: 30,383,519 probably null Het
Pcdha1 A G 18: 36,931,707 I475V probably benign Het
Pcgf1 A G 6: 83,080,085 E199G possibly damaging Het
Pip C A 6: 41,851,848 T109K probably benign Het
Slc12a7 A G 13: 73,784,570 E59G probably benign Het
Slc38a2 T C 15: 96,693,172 I237V probably benign Het
Slc6a5 T C 7: 49,945,519 V543A probably benign Het
Slc9a2 T C 1: 40,719,051 V250A possibly damaging Het
Smarcad1 T C 6: 65,073,230 Y278H probably damaging Het
Snx7 A T 3: 117,837,214 N248K probably benign Het
Spata6 T A 4: 111,720,231 C9S probably benign Het
Stra6l T A 4: 45,885,293 L587Q probably damaging Het
Tmem131l G T 3: 83,922,986 N916K possibly damaging Het
Tmprss11c C T 5: 86,237,657 V319I probably benign Het
Tpo A T 12: 30,119,442 I98K possibly damaging Het
Umodl1 A G 17: 30,996,393 T1064A probably damaging Het
Vldlr T C 19: 27,238,775 I332T probably damaging Het
Wdr75 T A 1: 45,803,904 L133Q probably damaging Het
Zdhhc21 T C 4: 82,835,450 N167S probably benign Het
Zfp37 A T 4: 62,191,667 C428S probably damaging Het
Other mutations in Aspm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Aspm APN 1 139478691 missense probably damaging 1.00
IGL00594:Aspm APN 1 139487422 splice site probably benign
IGL00808:Aspm APN 1 139461476 missense probably benign 0.03
IGL00897:Aspm APN 1 139477407 missense probably damaging 0.98
IGL01024:Aspm APN 1 139478124 missense possibly damaging 0.66
IGL01410:Aspm APN 1 139482444 missense probably benign 0.25
IGL01588:Aspm APN 1 139478162 missense probably benign 0.11
IGL01610:Aspm APN 1 139489670 nonsense probably null
IGL01633:Aspm APN 1 139480836 missense possibly damaging 0.93
IGL01982:Aspm APN 1 139491588 missense probably benign 0.12
IGL02429:Aspm APN 1 139479810 missense probably benign 0.27
IGL02468:Aspm APN 1 139480950 missense probably damaging 1.00
IGL02519:Aspm APN 1 139461927 splice site probably benign
IGL02526:Aspm APN 1 139489719 missense probably benign 0.03
IGL02716:Aspm APN 1 139479687 missense probably damaging 1.00
IGL02876:Aspm APN 1 139473653 missense probably damaging 1.00
IGL02953:Aspm APN 1 139457419 missense probably benign 0.01
IGL03275:Aspm APN 1 139487295 missense probably damaging 1.00
Stemware UTSW 1 139477459 nonsense probably null
3-1:Aspm UTSW 1 139457541 missense probably benign
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0140:Aspm UTSW 1 139480641 missense probably benign 0.00
R0195:Aspm UTSW 1 139479135 missense probably damaging 1.00
R0217:Aspm UTSW 1 139457880 missense possibly damaging 0.46
R0276:Aspm UTSW 1 139478471 missense possibly damaging 0.95
R0309:Aspm UTSW 1 139482511 splice site probably benign
R0466:Aspm UTSW 1 139477901 missense probably damaging 1.00
R0520:Aspm UTSW 1 139478820 missense possibly damaging 0.51
R0615:Aspm UTSW 1 139487289 missense probably damaging 1.00
R0626:Aspm UTSW 1 139491601 missense probably damaging 1.00
R0660:Aspm UTSW 1 139457764 missense probably benign 0.03
R0751:Aspm UTSW 1 139456898 splice site probably benign
R0830:Aspm UTSW 1 139474254 missense probably damaging 0.99
R1109:Aspm UTSW 1 139456758 missense probably damaging 0.99
R1114:Aspm UTSW 1 139461924 splice site probably benign
R1130:Aspm UTSW 1 139477834 missense possibly damaging 0.90
R1298:Aspm UTSW 1 139457419 missense probably benign 0.01
R1386:Aspm UTSW 1 139457623 missense probably benign 0.03
R1386:Aspm UTSW 1 139478972 missense possibly damaging 0.80
R1557:Aspm UTSW 1 139468668 missense probably benign 0.01
R1625:Aspm UTSW 1 139481039 missense probably benign 0.01
R1728:Aspm UTSW 1 139473574 missense probably benign
R1729:Aspm UTSW 1 139473574 missense probably benign
R1730:Aspm UTSW 1 139473574 missense probably benign
R1733:Aspm UTSW 1 139457117 missense probably benign 0.27
R1739:Aspm UTSW 1 139473574 missense probably benign
R1762:Aspm UTSW 1 139473574 missense probably benign
R1783:Aspm UTSW 1 139473574 missense probably benign
R1784:Aspm UTSW 1 139473574 missense probably benign
R1785:Aspm UTSW 1 139473574 missense probably benign
R1793:Aspm UTSW 1 139457341 missense probably benign 0.00
R1893:Aspm UTSW 1 139479867 missense probably damaging 1.00
R1911:Aspm UTSW 1 139478094 missense probably benign 0.06
R2103:Aspm UTSW 1 139491665 missense probably damaging 0.99
R2128:Aspm UTSW 1 139457635 missense probably benign 0.14
R2129:Aspm UTSW 1 139457635 missense probably benign 0.14
R2239:Aspm UTSW 1 139456846 missense possibly damaging 0.67
R2352:Aspm UTSW 1 139457562 missense probably benign 0.02
R2353:Aspm UTSW 1 139477697 missense probably damaging 1.00
R2380:Aspm UTSW 1 139479348 missense probably damaging 1.00
R2413:Aspm UTSW 1 139477757 missense probably damaging 1.00
R2421:Aspm UTSW 1 139488487 missense possibly damaging 0.49
R3607:Aspm UTSW 1 139480668 missense probably benign 0.13
R3711:Aspm UTSW 1 139458100 missense probably benign 0.17
R3718:Aspm UTSW 1 139480889 missense probably benign 0.09
R3718:Aspm UTSW 1 139490427 missense probably benign 0.31
R3741:Aspm UTSW 1 139478619 missense possibly damaging 0.47
R3788:Aspm UTSW 1 139463203 missense probably damaging 1.00
R3838:Aspm UTSW 1 139478054 missense probably benign 0.24
R3839:Aspm UTSW 1 139478054 missense probably benign 0.24
R3849:Aspm UTSW 1 139458286 missense probably benign 0.21
R4075:Aspm UTSW 1 139474285 missense probably damaging 1.00
R4080:Aspm UTSW 1 139470755 missense probably damaging 1.00
R4463:Aspm UTSW 1 139455010 missense possibly damaging 0.95
R4537:Aspm UTSW 1 139474303 missense probably benign 0.01
R4547:Aspm UTSW 1 139478187 missense possibly damaging 0.75
R4573:Aspm UTSW 1 139479507 missense probably damaging 0.98
R4680:Aspm UTSW 1 139480671 missense probably benign 0.05
R4807:Aspm UTSW 1 139477919 missense probably damaging 1.00
R4840:Aspm UTSW 1 139470531 missense possibly damaging 0.83
R4854:Aspm UTSW 1 139478072 nonsense probably null
R4859:Aspm UTSW 1 139469393 missense probably damaging 1.00
R4893:Aspm UTSW 1 139489839 critical splice donor site probably null
R4910:Aspm UTSW 1 139491543 missense probably damaging 1.00
R4953:Aspm UTSW 1 139471734 missense probably benign 0.00
R4974:Aspm UTSW 1 139478010 missense probably benign 0.03
R4981:Aspm UTSW 1 139470760 splice site probably null
R5082:Aspm UTSW 1 139478676 nonsense probably null
R5223:Aspm UTSW 1 139478334 missense probably damaging 1.00
R5268:Aspm UTSW 1 139464295 missense probably damaging 1.00
R5371:Aspm UTSW 1 139470541 nonsense probably null
R5377:Aspm UTSW 1 139457483 missense probably damaging 0.96
R5377:Aspm UTSW 1 139470395 splice site probably null
R5481:Aspm UTSW 1 139457061 missense possibly damaging 0.85
R5513:Aspm UTSW 1 139482398 missense probably damaging 1.00
R5578:Aspm UTSW 1 139470717 missense probably damaging 1.00
R5649:Aspm UTSW 1 139479669 missense probably benign
R5685:Aspm UTSW 1 139487288 missense probably benign 0.10
R5695:Aspm UTSW 1 139479669 missense probably benign
R5766:Aspm UTSW 1 139479002 missense probably damaging 0.99
R5964:Aspm UTSW 1 139455227 intron probably benign
R5993:Aspm UTSW 1 139479531 missense probably benign 0.28
R6027:Aspm UTSW 1 139463056 missense probably damaging 1.00
R6029:Aspm UTSW 1 139480990 missense possibly damaging 0.83
R6102:Aspm UTSW 1 139477459 nonsense probably null
R6188:Aspm UTSW 1 139479239 missense possibly damaging 0.79
R6257:Aspm UTSW 1 139482053 splice site probably null
R6433:Aspm UTSW 1 139473683 missense probably damaging 1.00
R6682:Aspm UTSW 1 139457722 missense possibly damaging 0.67
R6763:Aspm UTSW 1 139470517 missense possibly damaging 0.64
R6798:Aspm UTSW 1 139468685 missense possibly damaging 0.66
R6815:Aspm UTSW 1 139480142 missense probably benign 0.04
R6854:Aspm UTSW 1 139463182 missense possibly damaging 0.90
R6928:Aspm UTSW 1 139480206 nonsense probably null
R6943:Aspm UTSW 1 139480542 missense probably damaging 1.00
R6979:Aspm UTSW 1 139480485 missense probably damaging 1.00
R6998:Aspm UTSW 1 139469472 missense probably damaging 1.00
R7126:Aspm UTSW 1 139480803 missense probably benign 0.27
R7237:Aspm UTSW 1 139477929 missense possibly damaging 0.81
R7240:Aspm UTSW 1 139478651 nonsense probably null
R7272:Aspm UTSW 1 139458328 missense probably benign 0.14
R7427:Aspm UTSW 1 139457616 missense probably benign 0.01
R7519:Aspm UTSW 1 139490336 missense possibly damaging 0.53
R7776:Aspm UTSW 1 139479846 missense possibly damaging 0.85
R7875:Aspm UTSW 1 139455134 missense probably benign 0.02
R7883:Aspm UTSW 1 139478667 missense possibly damaging 0.47
R7964:Aspm UTSW 1 139480686 missense probably damaging 1.00
R8012:Aspm UTSW 1 139457464 missense probably benign 0.03
R8029:Aspm UTSW 1 139471632 missense probably benign 0.00
R8233:Aspm UTSW 1 139457304 missense probably benign 0.28
R8277:Aspm UTSW 1 139455010 missense probably damaging 1.00
R8345:Aspm UTSW 1 139464273 nonsense probably null
R8491:Aspm UTSW 1 139457695 missense probably damaging 0.98
R8511:Aspm UTSW 1 139457308 missense probably damaging 1.00
R8557:Aspm UTSW 1 139456756 missense probably benign 0.01
R8927:Aspm UTSW 1 139490387 nonsense probably null
R8928:Aspm UTSW 1 139490387 nonsense probably null
R8950:Aspm UTSW 1 139478952 missense probably damaging 1.00
R9033:Aspm UTSW 1 139478127 missense probably damaging 1.00
R9083:Aspm UTSW 1 139493698 missense possibly damaging 0.70
R9133:Aspm UTSW 1 139491528 missense probably damaging 1.00
R9160:Aspm UTSW 1 139490124 missense probably damaging 1.00
R9179:Aspm UTSW 1 139476715 missense probably damaging 1.00
R9265:Aspm UTSW 1 139461444 missense probably benign 0.24
R9419:Aspm UTSW 1 139457185 missense probably benign 0.29
R9454:Aspm UTSW 1 139480994 missense probably benign 0.00
R9517:Aspm UTSW 1 139479429 missense probably damaging 1.00
R9524:Aspm UTSW 1 139480869 missense probably damaging 1.00
R9544:Aspm UTSW 1 139457785 missense probably benign 0.01
X0063:Aspm UTSW 1 139458090 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAAGATGAGAACAGCAGCTC -3'
(R):5'- CTCTGAATGAGAGTAGCAGCC -3'

Sequencing Primer
(F):5'- CAGCAGCTCTTATAATTCAGGTGAG -3'
(R):5'- CAGCCAGGTGCATAGCTTTTAAG -3'
Posted On 2022-04-20