Incidental Mutation 'R9400:Umodl1'
ID 711078
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 30954679-31010708 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30996393 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1064 (T1064A)
Ref Sequence ENSEMBL: ENSMUSP00000067443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect probably damaging
Transcript: ENSMUST00000066554
AA Change: T1064A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: T1064A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000066981
AA Change: T949A
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: T949A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114555
AA Change: T1064A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: T1064A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 8,992,286 N89S probably benign Het
9930111J21Rik1 C T 11: 48,948,417 E448K possibly damaging Het
Acer1 G A 17: 56,981,990 T40M probably damaging Het
Adam1a T C 5: 121,519,830 T467A probably benign Het
Agmat A G 4: 141,749,670 D129G probably damaging Het
Ak8 T A 2: 28,759,999 I346N probably benign Het
Ankrd12 A T 17: 65,984,880 V1186E probably damaging Het
Ankrd27 T G 7: 35,616,857 L516R probably damaging Het
Aplp2 C A 9: 31,164,559 R402L possibly damaging Het
Aspm A G 1: 139,479,903 Y2176C probably damaging Het
Boc T C 16: 44,499,481 D380G Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Chst2 T C 9: 95,405,589 S235G probably benign Het
Clca4b A G 3: 144,911,192 V899A probably benign Het
Ddx1 A G 12: 13,223,702 S617P probably damaging Het
Etv5 A T 16: 22,401,726 F304I probably benign Het
Fmo9 T G 1: 166,677,674 E50A probably benign Het
Gbp11 T C 5: 105,330,975 E199G probably damaging Het
Gemin5 C T 11: 58,137,715 G893D probably damaging Het
Gorab G T 1: 163,396,998 P78Q probably damaging Het
Gprc5a A G 6: 135,078,560 T2A probably benign Het
Gtf3c1 A G 7: 125,676,511 I581T probably damaging Het
H6pd A G 4: 149,995,791 F199S probably damaging Het
Hdac3 A T 18: 37,937,624 V426E possibly damaging Het
Jag2 G T 12: 112,911,988 Y838* probably null Het
Kat6b G T 14: 21,609,758 R210L probably damaging Het
Kctd11 C A 11: 69,879,718 E165* probably null Het
Knl1 T C 2: 119,100,743 V1980A probably damaging Het
Lilr4b T C 10: 51,481,223 S52P probably benign Het
Lrp5 T G 19: 3,585,272 M1535L probably benign Het
Lrr1 A G 12: 69,174,702 D206G probably benign Het
Lrrd1 G A 5: 3,849,677 probably benign Het
Map3k6 C A 4: 133,241,156 A23E probably damaging Het
Mgat4a T C 1: 37,462,944 D241G probably damaging Het
Mpzl3 A G 9: 45,074,779 Y237C possibly damaging Het
Mroh1 A G 15: 76,451,893 E1489G possibly damaging Het
Myocd T C 11: 65,196,108 H331R probably benign Het
Myoz1 T A 14: 20,649,436 H278L probably benign Het
Olfr102 A T 17: 37,313,663 C240* probably null Het
Olfr1199 A G 2: 88,755,949 I242T possibly damaging Het
Olfr1441 C A 19: 12,422,910 N200K possibly damaging Het
Olfr1449 T A 19: 12,935,514 Y259N probably damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr381 A T 11: 73,485,981 V281E probably damaging Het
Otof A T 5: 30,383,519 probably null Het
Pcdha1 A G 18: 36,931,707 I475V probably benign Het
Pcgf1 A G 6: 83,080,085 E199G possibly damaging Het
Pip C A 6: 41,851,848 T109K probably benign Het
Slc12a7 A G 13: 73,784,570 E59G probably benign Het
Slc38a2 T C 15: 96,693,172 I237V probably benign Het
Slc6a5 T C 7: 49,945,519 V543A probably benign Het
Slc9a2 T C 1: 40,719,051 V250A possibly damaging Het
Smarcad1 T C 6: 65,073,230 Y278H probably damaging Het
Snx7 A T 3: 117,837,214 N248K probably benign Het
Spata6 T A 4: 111,720,231 C9S probably benign Het
Stra6l T A 4: 45,885,293 L587Q probably damaging Het
Tmem131l G T 3: 83,922,986 N916K possibly damaging Het
Tmprss11c C T 5: 86,237,657 V319I probably benign Het
Tpo A T 12: 30,119,442 I98K possibly damaging Het
Vldlr T C 19: 27,238,775 I332T probably damaging Het
Wdr75 T A 1: 45,803,904 L133Q probably damaging Het
Zdhhc21 T C 4: 82,835,450 N167S probably benign Het
Zfp37 A T 4: 62,191,667 C428S probably damaging Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
Disquieting UTSW 17 30959155 missense probably damaging 1.00
floored UTSW 17 30988057 nonsense probably null
R7231_umodl1_507 UTSW 17 30986116 missense probably damaging 1.00
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
G1citation:Umodl1 UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 30986387 missense probably benign 0.00
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
R8826:Umodl1 UTSW 17 30983984 missense possibly damaging 0.65
R9067:Umodl1 UTSW 17 30973703 missense probably damaging 1.00
R9091:Umodl1 UTSW 17 30966704 missense probably damaging 1.00
R9099:Umodl1 UTSW 17 30959173 missense probably benign 0.01
R9270:Umodl1 UTSW 17 30966704 missense probably damaging 1.00
R9341:Umodl1 UTSW 17 30998727 missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 30998727 missense possibly damaging 0.95
R9569:Umodl1 UTSW 17 30998169 missense probably damaging 1.00
R9615:Umodl1 UTSW 17 30998178 missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 30959350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCCTTGGAACCTGCAG -3'
(R):5'- AGCTTAGAAGTCAGAGGCCCAG -3'

Sequencing Primer
(F):5'- AGGTGACCCTTCTGGCAACATG -3'
(R):5'- GGAGTGAATAAGAGCCTTCCTGGTC -3'
Posted On 2022-04-20