Incidental Mutation 'R8830:BC017643'
ID 711096
Institutional Source Beutler Lab
Gene Symbol BC017643
Ensembl Gene ENSMUSG00000039294
Gene Name cDNA sequence BC017643
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8830 (G1)
Quality Score 168.009
Status Validated
Chromosome 11
Chromosomal Location 121222588-121229322 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) C to T at 121228723 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038709] [ENSMUST00000106115] [ENSMUST00000137299] [ENSMUST00000147490] [ENSMUST00000169393]
AlphaFold Q3TYS2
Predicted Effect probably benign
Transcript: ENSMUST00000038709
SMART Domains Protein: ENSMUSP00000042277
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 187 1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106115
SMART Domains Protein: ENSMUSP00000101721
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 2 184 3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137299
SMART Domains Protein: ENSMUSP00000120541
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 150 9.9e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147490
SMART Domains Protein: ENSMUSP00000117829
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 132 7.2e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169393
SMART Domains Protein: ENSMUSP00000127260
Gene: ENSMUSG00000039294

DomainStartEndE-ValueType
Pfam:DUF4564 1 51 6.9e-20 PFAM
low complexity region 67 78 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 G A 13: 64,297,300 Q170* probably null Het
Abca7 T A 10: 80,008,971 V1509E probably damaging Het
Abraxas2 A G 7: 132,883,356 D376G probably damaging Het
Agbl1 A G 7: 76,335,311 T159A Het
Ahnak2 G A 12: 112,787,036 R89W Het
Arhgef40 A C 14: 52,003,708 D1396A probably damaging Het
Atp13a5 A T 16: 29,248,176 F1060I probably damaging Het
Atp6v1c1 T A 15: 38,677,545 F105I probably damaging Het
Atp9b C T 18: 80,765,800 E635K Het
Brix1 T A 15: 10,479,596 Q124L possibly damaging Het
Cep68 A G 11: 20,230,418 probably benign Het
Cfap46 A G 7: 139,615,649 S2208P unknown Het
Crisp1 T A 17: 40,294,419 K234* probably null Het
Cryzl1 C T 16: 91,712,204 V70I probably benign Het
Dnah7b T C 1: 46,191,793 Y1404H probably damaging Het
Dot1l A G 10: 80,771,199 H109R possibly damaging Het
E330034G19Rik A C 14: 24,309,508 H329P unknown Het
Erbb4 A T 1: 68,075,468 L939Q probably damaging Het
Fst A T 13: 114,455,828 C118S probably damaging Het
Gfra3 A G 18: 34,711,136 V117A possibly damaging Het
Gldc C G 19: 30,100,812 M928I probably benign Het
Gm5538 A T 3: 59,747,323 T193S probably benign Het
Gm996 T G 2: 25,577,250 D883A Het
Greb1 A G 12: 16,688,519 M1481T probably benign Het
Hecw2 G A 1: 53,891,146 R1045C probably damaging Het
Hexb C T 13: 97,194,254 V84I probably benign Het
Hpse T C 5: 100,695,586 E240G probably benign Het
Hspa12a T C 19: 58,805,463 D322G possibly damaging Het
Hspa9 A T 18: 34,948,104 probably null Het
Kif9 A G 9: 110,524,930 K790R probably damaging Het
Klc2 C T 19: 5,110,366 probably null Het
Ldha C G 7: 46,850,278 N144K probably benign Het
Micalcl A G 7: 112,381,196 T126A probably benign Het
Mrpl15 A T 1: 4,782,584 V137D probably damaging Het
Muc16 G A 9: 18,646,069 T2976I unknown Het
Mybpc2 A T 7: 44,512,541 V495D probably damaging Het
Olfr597 A G 7: 103,321,005 K198R Het
Olfr713 A G 7: 107,036,682 N176D probably benign Het
Olfr772 A T 10: 129,174,846 Y58* probably null Het
Pcnt G A 10: 76,382,174 T2089I probably benign Het
Pdzd7 T C 19: 45,033,073 D563G probably damaging Het
Phlpp1 T G 1: 106,350,603 L915R probably damaging Het
Plekhh2 T A 17: 84,521,803 I34N probably damaging Het
Pou6f2 T A 13: 18,378,498 T84S Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Pvrig T G 5: 138,342,148 probably benign Het
Rasl10b A T 11: 83,412,676 I20F probably damaging Het
Rimbp3 T A 16: 17,209,006 V98E probably damaging Het
Rims2 T C 15: 39,437,362 I355T possibly damaging Het
Slc1a2 A G 2: 102,736,015 H30R probably benign Het
Slc28a1 G A 7: 81,161,046 V389M possibly damaging Het
Slc7a13 T C 4: 19,819,189 S130P probably benign Het
Sp140 TTTTTTTT TTTTTTTTTTTTT 1: 85,644,574 probably benign Het
Spag17 T A 3: 100,125,435 H2320Q possibly damaging Het
Speer4a T C 5: 26,036,795 E111G possibly damaging Het
Ss18l1 T C 2: 180,067,338 Y397H unknown Het
Tbck T C 3: 132,838,057 S890P probably damaging Het
Tcp11 T C 17: 28,080,230 E17G probably benign Het
Tesk2 C T 4: 116,802,287 R315C probably benign Het
Tln1 T C 4: 43,556,383 N45S probably benign Het
Trim10 C T 17: 36,869,954 P26S probably damaging Het
Vmac C A 17: 56,715,573 G146C probably damaging Het
Vmn1r14 G A 6: 57,234,032 M198I probably damaging Het
Vmn1r194 T C 13: 22,244,836 Y208H possibly damaging Het
Vmn1r78 G A 7: 12,153,191 C243Y probably damaging Het
Wasf3 C T 5: 146,466,862 Q261* probably null Het
Ybx2 A G 11: 69,936,237 K88R probably benign Het
Zfhx4 G A 3: 5,398,889 R1394H probably damaging Het
Zfp871 T C 17: 32,774,927 T425A probably benign Het
Zfy2 C T Y: 2,106,600 S678N possibly damaging Het
Zswim4 T C 8: 84,223,316 E650G possibly damaging Het
Other mutations in BC017643
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:BC017643 APN 11 121228330 missense probably damaging 1.00
IGL01476:BC017643 APN 11 121225845 missense probably damaging 1.00
R0737:BC017643 UTSW 11 121227242 critical splice donor site probably null
R4067:BC017643 UTSW 11 121224702 splice site probably null
R4162:BC017643 UTSW 11 121224666 missense probably damaging 0.99
R4523:BC017643 UTSW 11 121224108 unclassified probably benign
R4524:BC017643 UTSW 11 121224108 unclassified probably benign
R8560:BC017643 UTSW 11 121224215 missense probably damaging 1.00
X0013:BC017643 UTSW 11 121228342 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCTCATTAGTCCAGTCAG -3'
(R):5'- CGCATTTGGGCCATTGTTAG -3'

Sequencing Primer
(F):5'- ACCCCGAACACCTTTCTCTTATGAG -3'
(R):5'- TAGGTAGTCTGGCGTCAATAAC -3'
Posted On 2022-04-20