Incidental Mutation 'R8934:Dusp16'
ID 711105
Institutional Source Beutler Lab
Gene Symbol Dusp16
Ensembl Gene ENSMUSG00000030203
Gene Name dual specificity phosphatase 16
Synonyms 3830417M17Rik, D6Ertd213e, MKP7, MKP-7
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock # R8934 (G1)
Quality Score 205.009
Status Validated
Chromosome 6
Chromosomal Location 134715468-134792625 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to T at 134741676 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100857] [ENSMUST00000129433] [ENSMUST00000149776] [ENSMUST00000204083]
AlphaFold Q6PCP3
Predicted Effect probably benign
Transcript: ENSMUST00000100857
SMART Domains Protein: ENSMUSP00000098419
Gene: ENSMUSG00000030203

DomainStartEndE-ValueType
RHOD 12 134 5.58e-16 SMART
DSPc 158 297 1.66e-68 SMART
Blast:DSPc 576 621 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129433
SMART Domains Protein: ENSMUSP00000115925
Gene: ENSMUSG00000030203

DomainStartEndE-ValueType
Blast:RHOD 1 67 8e-41 BLAST
PDB:2VSW|B 1 83 1e-52 PDB
DSPc 91 232 3.73e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148926
Predicted Effect probably benign
Transcript: ENSMUST00000149776
SMART Domains Protein: ENSMUSP00000144784
Gene: ENSMUSG00000030203

DomainStartEndE-ValueType
RHOD 12 134 5.58e-16 SMART
Blast:DSPc 158 203 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000204083
SMART Domains Protein: ENSMUSP00000144834
Gene: ENSMUSG00000030203

DomainStartEndE-ValueType
RHOD 12 124 1.5e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitogen-activated protein kinase phosphatase that is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. The encoded protein specifically regulates the c-Jun amino-terminal kinase (JNK) and extracellular signal-regulated kinase (ERK) pathways.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality and decreased birth weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik G A 14: 32,660,657 S1117L possibly damaging Het
Abce1 A G 8: 79,703,032 Y87H probably damaging Het
Adad2 G A 8: 119,614,796 probably benign Het
Adamts12 A G 15: 11,299,929 T901A probably damaging Het
Adamts18 T A 8: 113,736,878 I779F possibly damaging Het
Bod1l T C 5: 41,819,601 T1457A probably benign Het
Brat1 T C 5: 140,710,249 V125A probably benign Het
C4b G A 17: 34,732,984 R1296C possibly damaging Het
C5ar1 A T 7: 16,248,477 L206Q probably damaging Het
Cfap126 A G 1: 171,126,121 T87A probably benign Het
Cnot1 A T 8: 95,765,067 N376K probably benign Het
Cyp3a44 A T 5: 145,794,976 I120K possibly damaging Het
Ddx17 T C 15: 79,536,016 E384G possibly damaging Het
Dnah14 T C 1: 181,622,723 S634P possibly damaging Het
Eml2 G A 7: 19,179,813 R185H probably damaging Het
Epdr1 T C 13: 19,593,180 E216G possibly damaging Het
Erv3 T C 2: 131,856,181 H86R probably benign Het
Fam69b G A 2: 26,634,854 V89M possibly damaging Het
Gm13119 C T 4: 144,363,775 L462F possibly damaging Het
Gm5114 A G 7: 39,411,129 W99R probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hfe2 T G 3: 96,526,593 C27G probably damaging Het
Ifrd2 T C 9: 107,592,270 probably benign Het
Ikbkb T C 8: 22,660,391 *758W probably null Het
Il1rap T C 16: 26,676,984 C114R probably damaging Het
Irf6 T C 1: 193,162,725 I168T probably benign Het
Kmt2d T C 15: 98,861,886 I1164V unknown Het
Lamb3 T C 1: 193,338,860 L915P probably damaging Het
Lca5 T C 9: 83,391,856 probably benign Het
Lhx3 C A 2: 26,202,246 R211L probably damaging Het
Mettl8 T C 2: 71,051,718 probably benign Het
Mroh1 T C 15: 76,450,186 S1297P probably benign Het
Myh14 T A 7: 44,657,428 T232S probably benign Het
Nemp2 T A 1: 52,649,709 F377L probably damaging Het
Obscn A G 11: 58,998,259 probably null Het
Olfr1272 T A 2: 90,282,012 T188S probably benign Het
Olfr615 T C 7: 103,561,083 V202A probably benign Het
Pgbd5 A C 8: 124,384,259 V231G possibly damaging Het
Pitrm1 T C 13: 6,556,630 L240P probably benign Het
Pkhd1 A G 1: 20,392,010 probably null Het
Ppp2r5a T A 1: 191,368,638 probably benign Het
Prss30 C T 17: 23,973,654 C147Y probably damaging Het
Ptpru C T 4: 131,818,986 V318M probably damaging Het
Rpap1 C T 2: 119,769,249 probably null Het
Rptn A G 3: 93,395,912 Q184R probably benign Het
Rufy1 T A 11: 50,407,878 Q362L probably benign Het
Rundc1 A G 11: 101,431,501 K274E probably damaging Het
Shroom3 T A 5: 92,941,725 I778K probably damaging Het
Slamf6 C T 1: 171,917,771 L22F possibly damaging Het
St7l A G 3: 104,889,318 E249G probably damaging Het
Tmem237 T C 1: 59,114,179 N61S probably benign Het
Tyk2 T C 9: 21,127,120 probably benign Het
Ubtf G T 11: 102,314,029 P115T probably damaging Het
Vmn2r70 T A 7: 85,561,980 I508F possibly damaging Het
Zfp609 C T 9: 65,703,279 A801T possibly damaging Het
Zfp663 A T 2: 165,352,794 C502S probably damaging Het
Other mutations in Dusp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Dusp16 APN 6 134725949 missense probably benign 0.13
IGL01305:Dusp16 APN 6 134718861 missense probably benign 0.03
IGL01331:Dusp16 APN 6 134718104 missense possibly damaging 0.53
IGL02535:Dusp16 APN 6 134718827 missense probably benign
IGL02606:Dusp16 APN 6 134761036 missense probably damaging 0.96
IGL02696:Dusp16 APN 6 134718435 missense probably damaging 0.99
ANU22:Dusp16 UTSW 6 134718861 missense probably benign 0.03
PIT4469001:Dusp16 UTSW 6 134761152 unclassified probably benign
PIT4504001:Dusp16 UTSW 6 134739883 missense possibly damaging 0.90
R0492:Dusp16 UTSW 6 134718402 missense probably benign
R0578:Dusp16 UTSW 6 134718321 missense probably damaging 1.00
R1630:Dusp16 UTSW 6 134720561 missense probably damaging 1.00
R1962:Dusp16 UTSW 6 134718136 nonsense probably null
R2004:Dusp16 UTSW 6 134718839 missense probably benign
R3690:Dusp16 UTSW 6 134761119 unclassified probably benign
R3730:Dusp16 UTSW 6 134718861 missense probably benign
R5778:Dusp16 UTSW 6 134718314 missense probably benign 0.01
R6267:Dusp16 UTSW 6 134720493 critical splice donor site probably null
R6296:Dusp16 UTSW 6 134720493 critical splice donor site probably null
R6860:Dusp16 UTSW 6 134725879 nonsense probably null
R7248:Dusp16 UTSW 6 134718977 missense probably benign 0.01
R7645:Dusp16 UTSW 6 134725925 missense probably damaging 0.97
R8108:Dusp16 UTSW 6 134739873 missense probably benign
R8743:Dusp16 UTSW 6 134717970 missense probably benign 0.35
R8824:Dusp16 UTSW 6 134739769 missense probably benign
R9328:Dusp16 UTSW 6 134739939 missense probably damaging 1.00
R9364:Dusp16 UTSW 6 134719019 missense probably damaging 1.00
R9430:Dusp16 UTSW 6 134760866 missense probably damaging 1.00
R9476:Dusp16 UTSW 6 134718263 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CACATGGGCAGTTGAAAGGTC -3'
(R):5'- GCTACTGATACCTGCTTGAGTG -3'

Sequencing Primer
(F):5'- GGTCTTAAGCTAAACTGGTGGAC -3'
(R):5'- TTTGCTGGGTGCCACAC -3'
Posted On 2022-04-27