Incidental Mutation 'R8903:Tecpr1'
ID 711129
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Name tectonin beta-propeller repeat containing 1
Synonyms 2210010N04Rik
MMRRC Submission 068760-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8903 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 144131260-144160433 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) C to T at 144150845 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
AlphaFold Q80VP0
Predicted Effect probably benign
Transcript: ENSMUST00000085701
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,815,526 (GRCm39) F258S probably damaging Het
Abca3 A G 17: 24,602,959 (GRCm39) Y518C probably damaging Het
Ank2 A T 3: 126,840,431 (GRCm39) N274K probably damaging Het
Ankrd31 C T 13: 96,969,329 (GRCm39) L989F probably damaging Het
Ano6 A G 15: 95,825,463 (GRCm39) R354G probably benign Het
Ano8 T C 8: 71,934,834 (GRCm39) probably null Het
Arfgef1 T C 1: 10,211,838 (GRCm39) Y1735C probably damaging Het
B3gnt8 G A 7: 25,328,659 (GRCm39) G363D probably benign Het
Calcrl T C 2: 84,203,729 (GRCm39) probably null Het
Cc2d2b A T 19: 40,797,726 (GRCm39) D782V unknown Het
Ccdc162 A G 10: 41,531,440 (GRCm39) probably null Het
Cdkal1 A T 13: 29,809,918 (GRCm39) *219R probably null Het
Clcnkb A T 4: 141,135,160 (GRCm39) V526D possibly damaging Het
Cnbp A T 6: 87,821,074 (GRCm39) C162S probably damaging Het
Coq2 A G 5: 100,811,656 (GRCm39) probably benign Het
D6Wsu163e T A 6: 126,931,778 (GRCm39) L270Q probably damaging Het
Dennd10 C T 19: 60,823,423 (GRCm39) Q353* probably null Het
Dnhd1 C T 7: 105,362,855 (GRCm39) Q3806* probably null Het
Eepd1 T C 9: 25,394,518 (GRCm39) F261L probably benign Het
Fes C T 7: 80,036,559 (GRCm39) probably benign Het
Fsip2 T A 2: 82,807,681 (GRCm39) D1333E possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,497,361 (GRCm39) probably null Het
Gm5113 T C 7: 29,878,292 (GRCm39) F127L probably benign Het
Grk3 A G 5: 113,066,697 (GRCm39) S596P possibly damaging Het
Gsk3a A G 7: 24,936,814 (GRCm39) V91A possibly damaging Het
Gss T C 2: 155,420,279 (GRCm39) K141E probably damaging Het
Il1rl2 A T 1: 40,366,530 (GRCm39) probably null Het
Kcnmb1 A G 11: 33,914,825 (GRCm39) Y42C probably damaging Het
Krtap16-1 A T 11: 99,877,170 (GRCm39) I78N probably damaging Het
Lrp2 C T 2: 69,379,382 (GRCm39) S110N possibly damaging Het
Lrrfip1 T A 1: 91,012,781 (GRCm39) probably benign Het
Magel2 G T 7: 62,029,441 (GRCm39) A782S unknown Het
Map1b C A 13: 99,569,017 (GRCm39) E1235* probably null Het
Mcpt1 A C 14: 56,257,520 (GRCm39) H222P probably benign Het
Met T A 6: 17,549,137 (GRCm39) N996K probably benign Het
Mia C A 7: 26,880,230 (GRCm39) Q52H probably damaging Het
Mia T A 7: 26,880,231 (GRCm39) Q52L possibly damaging Het
Myh7 T A 14: 55,230,228 (GRCm39) K35* probably null Het
Myt1l T A 12: 29,861,468 (GRCm39) D83E unknown Het
Nbl1 A G 4: 138,810,861 (GRCm39) V111A probably damaging Het
Nid1 T A 13: 13,638,515 (GRCm39) V145D probably benign Het
Nif3l1 C T 1: 58,486,653 (GRCm39) probably benign Het
Npnt T C 3: 132,591,764 (GRCm39) Y500C probably damaging Het
Nubpl T A 12: 52,144,676 (GRCm39) probably null Het
Nxpe4 T A 9: 48,310,250 (GRCm39) D504E probably damaging Het
Obsl1 A G 1: 75,463,917 (GRCm39) V1696A possibly damaging Het
Or56a3 A T 7: 104,735,329 (GRCm39) R135S possibly damaging Het
Or8s2 A T 15: 98,276,475 (GRCm39) I172N probably damaging Het
P2rx1 A T 11: 72,900,821 (GRCm39) H224L probably benign Het
Pald1 A T 10: 61,182,815 (GRCm39) probably null Het
Pard6g C T 18: 80,160,411 (GRCm39) R175* probably null Het
Pisd A G 5: 32,895,755 (GRCm39) I271T probably benign Het
Prrt3 T C 6: 113,472,796 (GRCm39) S459G probably damaging Het
Psd3 A T 8: 68,165,945 (GRCm39) C328S unknown Het
Psme1 A G 14: 55,817,853 (GRCm39) E120G Het
Pum3 A T 19: 27,397,457 (GRCm39) M306K possibly damaging Het
Pxdn T C 12: 30,040,992 (GRCm39) F423L probably benign Het
Rac3 A G 11: 120,614,071 (GRCm39) D118G probably damaging Het
Rnf14 A G 18: 38,446,267 (GRCm39) K357E probably benign Het
Rpl23a T C 11: 78,073,720 (GRCm39) I40V probably benign Het
Slc5a5 A T 8: 71,345,227 (GRCm39) S27T probably damaging Het
Slc7a14 A T 3: 31,277,595 (GRCm39) L670Q probably damaging Het
Snorc C T 1: 87,402,826 (GRCm39) T52I probably damaging Het
Sst T A 16: 23,708,499 (GRCm39) K111* probably null Het
Stxbp4 A G 11: 90,426,267 (GRCm39) S514P unknown Het
Susd1 T A 4: 59,390,576 (GRCm39) T300S probably benign Het
Tmem185b C T 1: 119,454,198 (GRCm39) probably benign Het
Tor2a T A 2: 32,651,699 (GRCm39) F305I probably damaging Het
Ttk T A 9: 83,750,113 (GRCm39) D689E probably damaging Het
Tut4 A T 4: 108,336,408 (GRCm39) D44V probably damaging Het
Usp25 A G 16: 76,878,421 (GRCm39) D615G probably damaging Het
Vmn1r209 A G 13: 22,990,684 (GRCm39) V2A probably benign Het
Vmn2r80 A C 10: 79,017,928 (GRCm39) E551A probably damaging Het
Wac G T 18: 7,926,104 (GRCm39) E636* probably null Het
Wdr53 T A 16: 32,071,130 (GRCm39) D158E probably damaging Het
Zbtb7c T C 18: 76,270,152 (GRCm39) V80A probably damaging Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144,145,411 (GRCm39) critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144,148,358 (GRCm39) missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144,153,737 (GRCm39) missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144,134,806 (GRCm39) splice site probably benign
IGL02244:Tecpr1 APN 5 144,146,821 (GRCm39) missense probably benign
IGL02247:Tecpr1 APN 5 144,143,372 (GRCm39) missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144,140,305 (GRCm39) missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144,143,364 (GRCm39) missense probably benign 0.28
larghissimo UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144,150,885 (GRCm39) missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144,147,017 (GRCm39) missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144,134,717 (GRCm39) missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144,155,335 (GRCm39) missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144,144,294 (GRCm39) missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144,132,759 (GRCm39) missense probably benign
R0504:Tecpr1 UTSW 5 144,150,899 (GRCm39) missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144,143,092 (GRCm39) missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144,154,219 (GRCm39) missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144,148,317 (GRCm39) missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144,150,871 (GRCm39) splice site probably null
R0835:Tecpr1 UTSW 5 144,149,410 (GRCm39) missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144,153,747 (GRCm39) missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144,143,357 (GRCm39) missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144,151,128 (GRCm39) missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144,134,762 (GRCm39) missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144,145,426 (GRCm39) missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144,143,347 (GRCm39) missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144,141,515 (GRCm39) missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144,145,463 (GRCm39) missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144,148,274 (GRCm39) missense probably benign 0.10
R2172:Tecpr1 UTSW 5 144,133,235 (GRCm39) missense probably damaging 1.00
R2290:Tecpr1 UTSW 5 144,150,881 (GRCm39) missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144,146,797 (GRCm39) missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144,143,077 (GRCm39) missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144,149,408 (GRCm39) missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144,144,255 (GRCm39) missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144,150,935 (GRCm39) missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144,141,476 (GRCm39) missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144,154,075 (GRCm39) missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144,134,672 (GRCm39) splice site probably null
R5459:Tecpr1 UTSW 5 144,144,234 (GRCm39) missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144,151,162 (GRCm39) missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144,155,451 (GRCm39) nonsense probably null
R5679:Tecpr1 UTSW 5 144,144,241 (GRCm39) missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144,143,364 (GRCm39) missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144,148,239 (GRCm39) missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144,136,009 (GRCm39) missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144,141,458 (GRCm39) missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144,135,394 (GRCm39) missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144,153,776 (GRCm39) missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144,146,792 (GRCm39) missense probably benign
R7276:Tecpr1 UTSW 5 144,153,838 (GRCm39) nonsense probably null
R7314:Tecpr1 UTSW 5 144,154,150 (GRCm39) missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144,145,417 (GRCm39) missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144,155,544 (GRCm39) missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144,140,236 (GRCm39) missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144,135,420 (GRCm39) missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144,137,658 (GRCm39) missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144,153,117 (GRCm39) missense possibly damaging 0.94
R8926:Tecpr1 UTSW 5 144,153,780 (GRCm39) missense probably damaging 1.00
R9218:Tecpr1 UTSW 5 144,154,049 (GRCm39) missense possibly damaging 0.70
R9423:Tecpr1 UTSW 5 144,155,396 (GRCm39) missense probably damaging 0.98
RF001:Tecpr1 UTSW 5 144,154,204 (GRCm39) missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144,155,409 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCCTGGAGATAGGGGATGATTC -3'
(R):5'- AATCTTGGCTGATGGAGACCG -3'

Sequencing Primer
(F):5'- AAAATTGGGTCCCCGACACTTTG -3'
(R):5'- TGATGGAGACCGCCTGG -3'
Posted On 2022-05-05