Incidental Mutation 'R9333:Vmn2r26'
ID 711159
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R9333 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 124026050 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 140 (P140S)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: P140S

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: P140S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik G T 4: 123,860,623 G110V probably benign Het
Abraxas1 T C 5: 100,812,073 S138G probably damaging Het
Aldoart1 C T 4: 72,852,130 R147H probably benign Het
Arfgef1 C A 1: 10,151,812 E1556* probably null Het
Arhgap39 C T 15: 76,735,125 R753H probably damaging Het
Asb2 G A 12: 103,345,696 Q56* probably null Het
Atp8b3 T C 10: 80,524,346 I964V probably benign Het
Baiap3 C A 17: 25,248,702 R338L possibly damaging Het
Clcn4 T A 7: 7,289,193 M540L probably damaging Het
Crbn T C 6: 106,800,023 H12R probably benign Het
D6Wsu163e A G 6: 126,975,133 Y530C probably damaging Het
Dolpp1 T A 2: 30,397,128 F191I probably damaging Het
Fam217a T C 13: 34,916,893 T94A probably benign Het
Fanci T C 7: 79,417,846 W347R possibly damaging Het
Fbxo39 A T 11: 72,317,523 N234Y probably damaging Het
Fbxo4 A G 15: 3,969,020 S319P probably benign Het
Gm14403 A G 2: 177,509,126 N46S probably benign Het
Grm2 C A 9: 106,648,217 R433L possibly damaging Het
Gtf2i C T 5: 134,242,986 D855N probably benign Het
Hcn2 T A 10: 79,726,157 M329K possibly damaging Het
Hsd3b3 T C 3: 98,741,900 D369G probably benign Het
Kctd12 T C 14: 102,981,618 K275E probably damaging Het
Klra4 T A 6: 130,044,117 K238N probably damaging Het
Kremen2 T A 17: 23,743,801 T104S probably damaging Het
Lmf2 G A 15: 89,355,374 L26F probably damaging Het
Mageb3 A T 2: 121,954,492 V243E probably damaging Het
Mfsd10 A G 5: 34,635,083 V258A probably damaging Het
Myh10 A C 11: 68,790,154 Q1007P probably benign Het
Ndufaf5 A G 2: 140,193,593 E243G probably benign Het
Olfr698 T C 7: 106,752,575 D271G probably damaging Het
Orm3 T C 4: 63,356,291 I31T probably damaging Het
Pgm1 C A 5: 64,105,757 T249K probably benign Het
Prcp T C 7: 92,928,686 Y388H probably damaging Het
Prmt3 T G 7: 49,806,560 I306M probably damaging Het
Rag2 A T 2: 101,630,407 D354V probably benign Het
Reep1 A G 6: 71,795,214 D162G probably damaging Het
Rnpep A T 1: 135,264,124 W575R probably damaging Het
Rpl28 T C 7: 4,793,080 probably benign Het
Ryr1 A C 7: 29,074,789 probably null Het
Spg11 G A 2: 122,101,763 R533C probably damaging Het
Tcf7l2 C A 19: 55,931,496 S487* probably null Het
Usp39 T C 6: 72,337,727 N232S probably benign Het
Vmn2r34 C T 7: 7,672,368 V674I probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124062024 missense probably benign
R9351:Vmn2r26 UTSW 6 124039374 missense probably benign
R9436:Vmn2r26 UTSW 6 124025867 missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTCTTTATATGCCTTAGATTGCTG -3'
(R):5'- TCGTGGGCTACATAGGAAGTTC -3'

Sequencing Primer
(F):5'- TCCAAAATTTGAGAGGGAGCACTG -3'
(R):5'- AGCCGTCCTATACCTCTTCAGTAAAC -3'
Posted On 2022-05-16