Incidental Mutation 'R9333:Vmn2r26'
ID 711159
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R9333 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 124003009 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 140 (P140S)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: P140S

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: P140S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik G T 4: 123,754,416 (GRCm39) G110V probably benign Het
Abraxas1 T C 5: 100,959,939 (GRCm39) S138G probably damaging Het
Aldoart1 C T 4: 72,770,367 (GRCm39) R147H probably benign Het
Arfgef1 C A 1: 10,222,037 (GRCm39) E1556* probably null Het
Arhgap39 C T 15: 76,619,325 (GRCm39) R753H probably damaging Het
Asb2 G A 12: 103,311,955 (GRCm39) Q56* probably null Het
Atp8b3 T C 10: 80,360,180 (GRCm39) I964V probably benign Het
Baiap3 C A 17: 25,467,676 (GRCm39) R338L possibly damaging Het
Clcn4 T A 7: 7,292,192 (GRCm39) M540L probably damaging Het
Crbn T C 6: 106,776,984 (GRCm39) H12R probably benign Het
D6Wsu163e A G 6: 126,952,096 (GRCm39) Y530C probably damaging Het
Dolpp1 T A 2: 30,287,140 (GRCm39) F191I probably damaging Het
Fam217a T C 13: 35,100,876 (GRCm39) T94A probably benign Het
Fanci T C 7: 79,067,594 (GRCm39) W347R possibly damaging Het
Fbxo39 A T 11: 72,208,349 (GRCm39) N234Y probably damaging Het
Fbxo4 A G 15: 3,998,502 (GRCm39) S319P probably benign Het
Gm14403 A G 2: 177,200,919 (GRCm39) N46S probably benign Het
Grm2 C A 9: 106,525,416 (GRCm39) R433L possibly damaging Het
Gtf2i C T 5: 134,271,840 (GRCm39) D855N probably benign Het
Hcn2 T A 10: 79,561,991 (GRCm39) M329K possibly damaging Het
Hsd3b3 T C 3: 98,649,216 (GRCm39) D369G probably benign Het
Kctd12 T C 14: 103,219,054 (GRCm39) K275E probably damaging Het
Klra4 T A 6: 130,021,080 (GRCm39) K238N probably damaging Het
Kremen2 T A 17: 23,962,775 (GRCm39) T104S probably damaging Het
Lmf2 G A 15: 89,239,577 (GRCm39) L26F probably damaging Het
Mageb3 A T 2: 121,784,973 (GRCm39) V243E probably damaging Het
Mfsd10 A G 5: 34,792,427 (GRCm39) V258A probably damaging Het
Myh10 A C 11: 68,680,980 (GRCm39) Q1007P probably benign Het
Ndufaf5 A G 2: 140,035,513 (GRCm39) E243G probably benign Het
Or2ag16 T C 7: 106,351,782 (GRCm39) D271G probably damaging Het
Orm3 T C 4: 63,274,528 (GRCm39) I31T probably damaging Het
Pgm2 C A 5: 64,263,100 (GRCm39) T249K probably benign Het
Prcp T C 7: 92,577,894 (GRCm39) Y388H probably damaging Het
Prmt3 T G 7: 49,456,308 (GRCm39) I306M probably damaging Het
Rag2 A T 2: 101,460,752 (GRCm39) D354V probably benign Het
Reep1 A G 6: 71,772,198 (GRCm39) D162G probably damaging Het
Rnpep A T 1: 135,191,862 (GRCm39) W575R probably damaging Het
Rpl28 T C 7: 4,796,079 (GRCm39) probably benign Het
Ryr1 A C 7: 28,774,214 (GRCm39) probably null Het
Spg11 G A 2: 121,932,244 (GRCm39) R533C probably damaging Het
Tcf7l2 C A 19: 55,919,928 (GRCm39) S487* probably null Het
Usp39 T C 6: 72,314,710 (GRCm39) N232S probably benign Het
Vmn2r34 C T 7: 7,675,367 (GRCm39) V674I probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTCTTTATATGCCTTAGATTGCTG -3'
(R):5'- TCGTGGGCTACATAGGAAGTTC -3'

Sequencing Primer
(F):5'- TCCAAAATTTGAGAGGGAGCACTG -3'
(R):5'- AGCCGTCCTATACCTCTTCAGTAAAC -3'
Posted On 2022-05-16