Mutagenetix > Incidental Mutation

Incidental Mutation 'R9333:Atp8b3'

711172

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R9333 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80524346 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 964 (I964V)

Ref Sequence

ENSEMBL: ENSMUSP00000020383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

probably benign
Transcript: ENSMUST00000020383
AA Change: I964V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: I964V

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220326

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427I04Rik	G	T	4: 123,860,623	G110V	probably benign	Het
Abraxas1	T	C	5: 100,812,073	S138G	probably damaging	Het
Aldoart1	C	T	4: 72,852,130	R147H	probably benign	Het
Arfgef1	C	A	1: 10,151,812	E1556*	probably null	Het
Arhgap39	C	T	15: 76,735,125	R753H	probably damaging	Het
Asb2	G	A	12: 103,345,696	Q56*	probably null	Het
Baiap3	C	A	17: 25,248,702	R338L	possibly damaging	Het
Clcn4	T	A	7: 7,289,193	M540L	probably damaging	Het
Crbn	T	C	6: 106,800,023	H12R	probably benign	Het
D6Wsu163e	A	G	6: 126,975,133	Y530C	probably damaging	Het
Dolpp1	T	A	2: 30,397,128	F191I	probably damaging	Het
Fam217a	T	C	13: 34,916,893	T94A	probably benign	Het
Fanci	T	C	7: 79,417,846	W347R	possibly damaging	Het
Fbxo39	A	T	11: 72,317,523	N234Y	probably damaging	Het
Fbxo4	A	G	15: 3,969,020	S319P	probably benign	Het
Gm14403	A	G	2: 177,509,126	N46S	probably benign	Het
Grm2	C	A	9: 106,648,217	R433L	possibly damaging	Het
Gtf2i	C	T	5: 134,242,986	D855N	probably benign	Het
Hcn2	T	A	10: 79,726,157	M329K	possibly damaging	Het
Hsd3b3	T	C	3: 98,741,900	D369G	probably benign	Het
Kctd12	T	C	14: 102,981,618	K275E	probably damaging	Het
Klra4	T	A	6: 130,044,117	K238N	probably damaging	Het
Kremen2	T	A	17: 23,743,801	T104S	probably damaging	Het
Lmf2	G	A	15: 89,355,374	L26F	probably damaging	Het
Mageb3	A	T	2: 121,954,492	V243E	probably damaging	Het
Mfsd10	A	G	5: 34,635,083	V258A	probably damaging	Het
Myh10	A	C	11: 68,790,154	Q1007P	probably benign	Het
Ndufaf5	A	G	2: 140,193,593	E243G	probably benign	Het
Olfr698	T	C	7: 106,752,575	D271G	probably damaging	Het
Orm3	T	C	4: 63,356,291	I31T	probably damaging	Het
Pgm1	C	A	5: 64,105,757	T249K	probably benign	Het
Prcp	T	C	7: 92,928,686	Y388H	probably damaging	Het
Prmt3	T	G	7: 49,806,560	I306M	probably damaging	Het
Rag2	A	T	2: 101,630,407	D354V	probably benign	Het
Reep1	A	G	6: 71,795,214	D162G	probably damaging	Het
Rnpep	A	T	1: 135,264,124	W575R	probably damaging	Het
Rpl28	T	C	7: 4,793,080		probably benign	Het
Ryr1	A	C	7: 29,074,789		probably null	Het
Spg11	G	A	2: 122,101,763	R533C	probably damaging	Het
Tcf7l2	C	A	19: 55,931,496	S487*	probably null	Het
Usp39	T	C	6: 72,337,727	N232S	probably benign	Het
Vmn2r26	C	T	6: 124,026,050	P140S	probably benign	Het
Vmn2r34	C	T	7: 7,672,368	V674I	probably benign	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCCCAAACTAATGCCCTCGG -3'
(R):5'- GCAGAGTCTCCAAAGTCCAC -3'

Sequencing Primer
(F):5'- ACAGGACTGAGCCTCCCTTC -3'
(R):5'- CACTCCAAAGTGTCAGAGTTGAGTG -3'

Posted On

2022-05-16