Incidental Mutation 'R9333:Atp8b3'
ID 711172
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene Name ATPase, class I, type 8B, member 3
Synonyms 1700042F02Rik, 1700056N23Rik, SAPLT
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9333 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 80355418-80374958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80360180 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 964 (I964V)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
AlphaFold Q6UQ17
Predicted Effect probably benign
Transcript: ENSMUST00000020383
AA Change: I964V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: I964V

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220326
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik G T 4: 123,754,416 (GRCm39) G110V probably benign Het
Abraxas1 T C 5: 100,959,939 (GRCm39) S138G probably damaging Het
Aldoart1 C T 4: 72,770,367 (GRCm39) R147H probably benign Het
Arfgef1 C A 1: 10,222,037 (GRCm39) E1556* probably null Het
Arhgap39 C T 15: 76,619,325 (GRCm39) R753H probably damaging Het
Asb2 G A 12: 103,311,955 (GRCm39) Q56* probably null Het
Baiap3 C A 17: 25,467,676 (GRCm39) R338L possibly damaging Het
Clcn4 T A 7: 7,292,192 (GRCm39) M540L probably damaging Het
Crbn T C 6: 106,776,984 (GRCm39) H12R probably benign Het
D6Wsu163e A G 6: 126,952,096 (GRCm39) Y530C probably damaging Het
Dolpp1 T A 2: 30,287,140 (GRCm39) F191I probably damaging Het
Fam217a T C 13: 35,100,876 (GRCm39) T94A probably benign Het
Fanci T C 7: 79,067,594 (GRCm39) W347R possibly damaging Het
Fbxo39 A T 11: 72,208,349 (GRCm39) N234Y probably damaging Het
Fbxo4 A G 15: 3,998,502 (GRCm39) S319P probably benign Het
Gm14403 A G 2: 177,200,919 (GRCm39) N46S probably benign Het
Grm2 C A 9: 106,525,416 (GRCm39) R433L possibly damaging Het
Gtf2i C T 5: 134,271,840 (GRCm39) D855N probably benign Het
Hcn2 T A 10: 79,561,991 (GRCm39) M329K possibly damaging Het
Hsd3b3 T C 3: 98,649,216 (GRCm39) D369G probably benign Het
Kctd12 T C 14: 103,219,054 (GRCm39) K275E probably damaging Het
Klra4 T A 6: 130,021,080 (GRCm39) K238N probably damaging Het
Kremen2 T A 17: 23,962,775 (GRCm39) T104S probably damaging Het
Lmf2 G A 15: 89,239,577 (GRCm39) L26F probably damaging Het
Mageb3 A T 2: 121,784,973 (GRCm39) V243E probably damaging Het
Mfsd10 A G 5: 34,792,427 (GRCm39) V258A probably damaging Het
Myh10 A C 11: 68,680,980 (GRCm39) Q1007P probably benign Het
Ndufaf5 A G 2: 140,035,513 (GRCm39) E243G probably benign Het
Or2ag16 T C 7: 106,351,782 (GRCm39) D271G probably damaging Het
Orm3 T C 4: 63,274,528 (GRCm39) I31T probably damaging Het
Pgm2 C A 5: 64,263,100 (GRCm39) T249K probably benign Het
Prcp T C 7: 92,577,894 (GRCm39) Y388H probably damaging Het
Prmt3 T G 7: 49,456,308 (GRCm39) I306M probably damaging Het
Rag2 A T 2: 101,460,752 (GRCm39) D354V probably benign Het
Reep1 A G 6: 71,772,198 (GRCm39) D162G probably damaging Het
Rnpep A T 1: 135,191,862 (GRCm39) W575R probably damaging Het
Rpl28 T C 7: 4,796,079 (GRCm39) probably benign Het
Ryr1 A C 7: 28,774,214 (GRCm39) probably null Het
Spg11 G A 2: 121,932,244 (GRCm39) R533C probably damaging Het
Tcf7l2 C A 19: 55,919,928 (GRCm39) S487* probably null Het
Usp39 T C 6: 72,314,710 (GRCm39) N232S probably benign Het
Vmn2r26 C T 6: 124,003,009 (GRCm39) P140S probably benign Het
Vmn2r34 C T 7: 7,675,367 (GRCm39) V674I probably benign Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80,366,821 (GRCm39) missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80,361,998 (GRCm39) splice site probably benign
IGL00904:Atp8b3 APN 10 80,364,598 (GRCm39) missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80,360,210 (GRCm39) missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80,370,063 (GRCm39) splice site probably benign
IGL01448:Atp8b3 APN 10 80,356,256 (GRCm39) missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80,366,802 (GRCm39) nonsense probably null
IGL01754:Atp8b3 APN 10 80,366,795 (GRCm39) splice site probably null
IGL01809:Atp8b3 APN 10 80,355,845 (GRCm39) missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80,357,662 (GRCm39) missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80,363,067 (GRCm39) splice site probably benign
IGL02224:Atp8b3 APN 10 80,361,810 (GRCm39) splice site probably benign
IGL02377:Atp8b3 APN 10 80,356,128 (GRCm39) missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80,366,462 (GRCm39) missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80,366,438 (GRCm39) missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80,370,292 (GRCm39) missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80,366,420 (GRCm39) missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80,362,743 (GRCm39) missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80,355,918 (GRCm39) missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80,370,032 (GRCm39) missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80,366,852 (GRCm39) missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80,356,017 (GRCm39) missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80,368,376 (GRCm39) missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80,361,619 (GRCm39) missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80,357,635 (GRCm39) splice site probably null
R1717:Atp8b3 UTSW 10 80,364,631 (GRCm39) missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80,365,912 (GRCm39) missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80,361,220 (GRCm39) nonsense probably null
R2138:Atp8b3 UTSW 10 80,362,939 (GRCm39) missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80,366,822 (GRCm39) missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80,362,728 (GRCm39) missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80,370,017 (GRCm39) missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80,355,746 (GRCm39) missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80,362,014 (GRCm39) missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80,365,540 (GRCm39) missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4518:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4519:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4619:Atp8b3 UTSW 10 80,361,858 (GRCm39) missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80,361,457 (GRCm39) missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80,372,604 (GRCm39) splice site probably null
R4774:Atp8b3 UTSW 10 80,372,156 (GRCm39) missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80,360,188 (GRCm39) missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80,357,676 (GRCm39) missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80,365,533 (GRCm39) missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80,356,007 (GRCm39) missense probably benign
R5990:Atp8b3 UTSW 10 80,361,531 (GRCm39) missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80,365,515 (GRCm39) missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80,356,157 (GRCm39) splice site probably null
R6748:Atp8b3 UTSW 10 80,361,058 (GRCm39) missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80,361,895 (GRCm39) missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80,365,552 (GRCm39) missense probably damaging 0.99
R7051:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7052:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80,365,926 (GRCm39) missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80,365,463 (GRCm39) critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80,360,240 (GRCm39) missense probably damaging 0.99
R7921:Atp8b3 UTSW 10 80,366,437 (GRCm39) missense probably damaging 1.00
R8077:Atp8b3 UTSW 10 80,366,858 (GRCm39) missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80,365,650 (GRCm39) missense probably damaging 0.96
R8354:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8454:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8501:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign
R8712:Atp8b3 UTSW 10 80,365,923 (GRCm39) missense possibly damaging 0.52
R8962:Atp8b3 UTSW 10 80,355,896 (GRCm39) missense probably benign 0.13
R9129:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R9438:Atp8b3 UTSW 10 80,361,409 (GRCm39) missense probably damaging 1.00
R9486:Atp8b3 UTSW 10 80,366,821 (GRCm39) missense probably damaging 1.00
R9554:Atp8b3 UTSW 10 80,360,197 (GRCm39) missense probably damaging 1.00
R9570:Atp8b3 UTSW 10 80,361,822 (GRCm39) missense probably benign 0.05
R9682:Atp8b3 UTSW 10 80,371,230 (GRCm39) missense probably damaging 1.00
R9748:Atp8b3 UTSW 10 80,364,407 (GRCm39) missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80,362,070 (GRCm39) missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80,366,911 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCCAAACTAATGCCCTCGG -3'
(R):5'- GCAGAGTCTCCAAAGTCCAC -3'

Sequencing Primer
(F):5'- ACAGGACTGAGCCTCCCTTC -3'
(R):5'- CACTCCAAAGTGTCAGAGTTGAGTG -3'
Posted On 2022-05-16