Incidental Mutation 'R9401:Ubr1'
ID 711192
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Name ubiquitin protein ligase E3 component n-recognin 1
Synonyms E3 alpha
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock # R9401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 120860269-120970715 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120935284 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 491 (T491S)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
AlphaFold O70481
Predicted Effect probably benign
Transcript: ENSMUST00000028728
AA Change: T491S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: T491S

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
Aars A G 8: 111,054,153 D850G probably benign Het
Abcc9 T A 6: 142,598,110 T1480S possibly damaging Het
Adgrb3 C A 1: 25,553,702 V335F probably damaging Het
Agfg1 C A 1: 82,882,237 A275D probably benign Het
Alms1 T A 6: 85,678,019 C2713* probably null Het
Atp8a1 G A 5: 67,749,149 A474V Het
Baz1a C A 12: 54,916,554 S918I probably damaging Het
Bcl2l12 G T 7: 44,994,250 T120K possibly damaging Het
Bcl6 G T 16: 23,972,357 Q416K possibly damaging Het
Cdhr1 T A 14: 37,098,098 I16F probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cilp T C 9: 65,278,099 V492A probably damaging Het
Crim1 CCGC CC 17: 78,350,865 probably null Het
Ctcfl T G 2: 173,106,088 T479P probably damaging Het
Dlx6 A C 6: 6,863,581 M68L probably benign Het
Dnah7a C A 1: 53,528,867 V1857F probably benign Het
Dpy19l4 A G 4: 11,265,806 V714A probably benign Het
Elovl7 T A 13: 108,282,654 N273K probably benign Het
Fbxo22 A G 9: 55,223,344 K299R probably benign Het
Fig4 A G 10: 41,267,737 V242A probably benign Het
Fmo9 A T 1: 166,677,620 M68K probably damaging Het
Fry T A 5: 150,378,938 Y537N probably damaging Het
Fryl C T 5: 73,065,220 W2006* probably null Het
Fzd8 T A 18: 9,213,205 C96S possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm4450 T G 3: 98,456,503 T9P probably damaging Het
Gspt1 T C 16: 11,232,671 D272G possibly damaging Het
Gzmf A T 14: 56,211,356 M1K probably null Het
Hipk1 T C 3: 103,777,979 T107A probably benign Het
Ighe C T 12: 113,269,487 C438Y Het
Igkv4-50 T A 6: 69,700,983 R46W Het
Igsf3 T A 3: 101,425,759 Y118N probably damaging Het
Ispd T C 12: 36,502,074 V309A probably benign Het
Itsn1 T A 16: 91,815,520 Y266N probably damaging Het
Jph3 A G 8: 121,785,115 E614G probably damaging Het
Klk1b8 T A 7: 43,954,250 D170E probably benign Het
Ly6e A T 15: 74,958,304 K36* probably null Het
Map3k6 C A 4: 133,241,156 A23E probably damaging Het
Med13l T A 5: 118,745,024 M1316K probably benign Het
Olfr1038-ps A T 2: 86,122,024 I34F possibly damaging Het
Olfr368 T C 2: 37,332,281 V178A possibly damaging Het
Olfr813 A G 10: 129,857,429 R304G probably benign Het
Pih1d2 T A 9: 50,618,605 C45S probably damaging Het
Pik3r2 G A 8: 70,771,093 S318L possibly damaging Het
Pknox1 T C 17: 31,583,778 I9T probably benign Het
Pknox2 T C 9: 36,923,745 I143V probably damaging Het
Polr1d A G 5: 147,078,678 Y57C probably damaging Het
Pum3 A T 19: 27,398,936 D527E probably benign Het
Rars2 T A 4: 34,654,819 H374Q probably damaging Het
Rassf9 G A 10: 102,512,508 probably benign Het
Rbl1 T A 2: 157,174,822 H619L possibly damaging Het
Scamp4 T C 10: 80,612,404 V153A probably benign Het
Sec23b T G 2: 144,578,366 I450S probably benign Het
Slc35b2 A G 17: 45,566,984 I297V probably benign Het
Slc4a4 C T 5: 89,179,666 T654I probably damaging Het
Slc6a5 T A 7: 49,951,437 M662K probably damaging Het
Smarcad1 T C 6: 65,094,337 Y589H probably benign Het
Stab1 A T 14: 31,161,112 F374I probably benign Het
Stat5a C T 11: 100,865,428 T158M possibly damaging Het
Trpc3 A T 3: 36,621,354 Y878* probably null Het
Uggt1 C T 1: 36,216,131 probably null Het
Ugt1a6a T A 1: 88,139,160 Y229* probably null Het
Vmn1r225 G A 17: 20,502,649 W117* probably null Het
Vmn1r225 A C 17: 20,502,650 K118Q probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r116 T C 17: 23,401,592 S767P probably damaging Het
Wdr90 AGAC AGACGAC 17: 25,845,776 probably benign Het
Ythdf3 C T 3: 16,204,495 P280S probably damaging Het
Zbbx A G 3: 75,112,083 S107P probably benign Het
Zdhhc7 A T 8: 120,086,686 V128E probably benign Het
Zfp235 A G 7: 24,142,126 S657G probably damaging Het
Zfp442 T A 2: 150,409,695 I96F possibly damaging Het
Zfp84 G A 7: 29,776,872 E330K probably damaging Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120875407 missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120941093 missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120930872 missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120914905 missense probably benign
IGL01346:Ubr1 APN 2 120873122 critical splice donor site probably null
IGL01368:Ubr1 APN 2 120941131 splice site probably benign
IGL01539:Ubr1 APN 2 120926013 missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120934342 missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120875398 missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120921386 missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120900508 missense probably benign 0.00
IGL02208:Ubr1 APN 2 120946349 missense probably benign 0.00
IGL02415:Ubr1 APN 2 120970603 utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120864373 missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120870979 splice site probably benign
IGL02627:Ubr1 APN 2 120940991 missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120914883 missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120941091 missense probably benign 0.01
IGL02939:Ubr1 APN 2 120881183 critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120961156 missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120864417 missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120895160 missense probably benign
I1329:Ubr1 UTSW 2 120934294 splice site probably benign
R0022:Ubr1 UTSW 2 120961173 splice site probably benign
R0345:Ubr1 UTSW 2 120904103 splice site probably null
R0373:Ubr1 UTSW 2 120946657 missense probably benign 0.01
R0393:Ubr1 UTSW 2 120906946 missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120881093 missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120947883 nonsense probably null
R0723:Ubr1 UTSW 2 120881101 nonsense probably null
R1178:Ubr1 UTSW 2 120926029 nonsense probably null
R1401:Ubr1 UTSW 2 120955644 missense probably benign 0.01
R1485:Ubr1 UTSW 2 120961098 missense probably benign 0.03
R1572:Ubr1 UTSW 2 120935319 splice site probably benign
R1920:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1921:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1997:Ubr1 UTSW 2 120946273 critical splice donor site probably null
R2129:Ubr1 UTSW 2 120942553 missense probably benign 0.35
R2147:Ubr1 UTSW 2 120864330 missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120926047 missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120909482 missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120963448 missense probably benign 0.02
R3930:Ubr1 UTSW 2 120916470 missense probably benign 0.20
R3979:Ubr1 UTSW 2 120862687 missense probably benign 0.11
R4172:Ubr1 UTSW 2 120946622 splice site probably null
R4173:Ubr1 UTSW 2 120946622 splice site probably null
R4174:Ubr1 UTSW 2 120946622 splice site probably null
R4241:Ubr1 UTSW 2 120934386 missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120970603 utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120895066 splice site probably null
R4449:Ubr1 UTSW 2 120946381 missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120942482 missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120926013 missense probably benign 0.35
R4765:Ubr1 UTSW 2 120963442 nonsense probably null
R4928:Ubr1 UTSW 2 120914938 missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120963566 missense probably benign 0.00
R5033:Ubr1 UTSW 2 120911997 critical splice donor site probably null
R5108:Ubr1 UTSW 2 120963422 missense probably benign 0.20
R5118:Ubr1 UTSW 2 120882264 missense probably benign 0.20
R5211:Ubr1 UTSW 2 120893170 missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120904044 missense probably benign 0.00
R5449:Ubr1 UTSW 2 120963500 missense probably benign
R5452:Ubr1 UTSW 2 120868302 missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120915407 missense probably benign
R5610:Ubr1 UTSW 2 120892112 missense probably benign 0.04
R5637:Ubr1 UTSW 2 120963517 missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120961092 missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120904005 missense probably benign
R5979:Ubr1 UTSW 2 120946382 missense probably benign 0.07
R6044:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R6146:Ubr1 UTSW 2 120893209 missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120906895 missense probably benign 0.21
R6389:Ubr1 UTSW 2 120881039 missense probably benign 0.03
R6600:Ubr1 UTSW 2 120915399 missense probably benign 0.00
R6670:Ubr1 UTSW 2 120924130 critical splice donor site probably null
R6731:Ubr1 UTSW 2 120955640 missense probably null 0.99
R6836:Ubr1 UTSW 2 120896675 splice site probably null
R6994:Ubr1 UTSW 2 120963593 missense probably benign
R7121:Ubr1 UTSW 2 120875498 missense probably benign 0.00
R7204:Ubr1 UTSW 2 120904077 missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120862765 missense probably benign 0.04
R7434:Ubr1 UTSW 2 120862680 missense probably benign
R7457:Ubr1 UTSW 2 120917828 missense probably benign 0.35
R7464:Ubr1 UTSW 2 120889774 critical splice donor site probably null
R7519:Ubr1 UTSW 2 120875444 missense possibly damaging 0.63
R7574:Ubr1 UTSW 2 120873191 missense possibly damaging 0.93
R8030:Ubr1 UTSW 2 120934374 missense probably damaging 0.99
R8085:Ubr1 UTSW 2 120934417 nonsense probably null
R8221:Ubr1 UTSW 2 120961104 missense probably damaging 0.97
R8241:Ubr1 UTSW 2 120963456 missense possibly damaging 0.80
R8291:Ubr1 UTSW 2 120911115 missense probably benign
R8293:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R8420:Ubr1 UTSW 2 120870995 missense probably benign
R8489:Ubr1 UTSW 2 120881067 missense probably benign 0.42
R8708:Ubr1 UTSW 2 120866483 missense probably benign 0.27
R8856:Ubr1 UTSW 2 120904042 missense probably damaging 1.00
R8995:Ubr1 UTSW 2 120866553 missense probably damaging 1.00
R9153:Ubr1 UTSW 2 120925988 missense probably benign 0.00
R9155:Ubr1 UTSW 2 120924134 missense possibly damaging 0.84
R9156:Ubr1 UTSW 2 120873122 critical splice donor site probably null
R9194:Ubr1 UTSW 2 120947844 missense probably damaging 1.00
R9320:Ubr1 UTSW 2 120896519 missense probably benign 0.04
R9430:Ubr1 UTSW 2 120904025 missense possibly damaging 0.59
R9515:Ubr1 UTSW 2 120873146 missense probably damaging 1.00
R9623:Ubr1 UTSW 2 120934339 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCAGCAGTCATTCTCTCATGTG -3'
(R):5'- TCTGCCCAGAGGTTCTAATTAC -3'

Sequencing Primer
(F):5'- GAAGTCCCAAGTTTGATTCCTAGCAC -3'
(R):5'- GCCCAGAGGTTCTAATTACTGTAAG -3'
Posted On 2022-05-16