Incidental Mutation 'R9401:Zfp442'
ID 711194
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Name zinc finger protein 442
Synonyms OTTMUSG00000015730
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 150407141-150451486 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150409695 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 96 (I96F)
Ref Sequence ENSEMBL: ENSMUSP00000105542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
AlphaFold A2AQA0
Predicted Effect possibly damaging
Transcript: ENSMUST00000109916
AA Change: I96F

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: I96F

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185796
AA Change: I95F

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130
AA Change: I95F

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
Aars A G 8: 111,054,153 D850G probably benign Het
Abcc9 T A 6: 142,598,110 T1480S possibly damaging Het
Adgrb3 C A 1: 25,553,702 V335F probably damaging Het
Agfg1 C A 1: 82,882,237 A275D probably benign Het
Alms1 T A 6: 85,678,019 C2713* probably null Het
Atp8a1 G A 5: 67,749,149 A474V Het
Baz1a C A 12: 54,916,554 S918I probably damaging Het
Bcl2l12 G T 7: 44,994,250 T120K possibly damaging Het
Bcl6 G T 16: 23,972,357 Q416K possibly damaging Het
Cdhr1 T A 14: 37,098,098 I16F probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cilp T C 9: 65,278,099 V492A probably damaging Het
Crim1 CCGC CC 17: 78,350,865 probably null Het
Ctcfl T G 2: 173,106,088 T479P probably damaging Het
Dlx6 A C 6: 6,863,581 M68L probably benign Het
Dnah7a C A 1: 53,528,867 V1857F probably benign Het
Dpy19l4 A G 4: 11,265,806 V714A probably benign Het
Elovl7 T A 13: 108,282,654 N273K probably benign Het
Fbxo22 A G 9: 55,223,344 K299R probably benign Het
Fig4 A G 10: 41,267,737 V242A probably benign Het
Fmo9 A T 1: 166,677,620 M68K probably damaging Het
Fry T A 5: 150,378,938 Y537N probably damaging Het
Fryl C T 5: 73,065,220 W2006* probably null Het
Fzd8 T A 18: 9,213,205 C96S possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm4450 T G 3: 98,456,503 T9P probably damaging Het
Gspt1 T C 16: 11,232,671 D272G possibly damaging Het
Gzmf A T 14: 56,211,356 M1K probably null Het
Hipk1 T C 3: 103,777,979 T107A probably benign Het
Ighe C T 12: 113,269,487 C438Y Het
Igkv4-50 T A 6: 69,700,983 R46W Het
Igsf3 T A 3: 101,425,759 Y118N probably damaging Het
Ispd T C 12: 36,502,074 V309A probably benign Het
Itsn1 T A 16: 91,815,520 Y266N probably damaging Het
Jph3 A G 8: 121,785,115 E614G probably damaging Het
Klk1b8 T A 7: 43,954,250 D170E probably benign Het
Ly6e A T 15: 74,958,304 K36* probably null Het
Map3k6 C A 4: 133,241,156 A23E probably damaging Het
Med13l T A 5: 118,745,024 M1316K probably benign Het
Olfr1038-ps A T 2: 86,122,024 I34F possibly damaging Het
Olfr368 T C 2: 37,332,281 V178A possibly damaging Het
Olfr813 A G 10: 129,857,429 R304G probably benign Het
Pih1d2 T A 9: 50,618,605 C45S probably damaging Het
Pik3r2 G A 8: 70,771,093 S318L possibly damaging Het
Pknox1 T C 17: 31,583,778 I9T probably benign Het
Pknox2 T C 9: 36,923,745 I143V probably damaging Het
Polr1d A G 5: 147,078,678 Y57C probably damaging Het
Pum3 A T 19: 27,398,936 D527E probably benign Het
Rars2 T A 4: 34,654,819 H374Q probably damaging Het
Rassf9 G A 10: 102,512,508 probably benign Het
Rbl1 T A 2: 157,174,822 H619L possibly damaging Het
Scamp4 T C 10: 80,612,404 V153A probably benign Het
Sec23b T G 2: 144,578,366 I450S probably benign Het
Slc35b2 A G 17: 45,566,984 I297V probably benign Het
Slc4a4 C T 5: 89,179,666 T654I probably damaging Het
Slc6a5 T A 7: 49,951,437 M662K probably damaging Het
Smarcad1 T C 6: 65,094,337 Y589H probably benign Het
Stab1 A T 14: 31,161,112 F374I probably benign Het
Stat5a C T 11: 100,865,428 T158M possibly damaging Het
Trpc3 A T 3: 36,621,354 Y878* probably null Het
Ubr1 T A 2: 120,935,284 T491S probably benign Het
Uggt1 C T 1: 36,216,131 probably null Het
Ugt1a6a T A 1: 88,139,160 Y229* probably null Het
Vmn1r225 G A 17: 20,502,649 W117* probably null Het
Vmn1r225 A C 17: 20,502,650 K118Q probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r116 T C 17: 23,401,592 S767P probably damaging Het
Wdr90 AGAC AGACGAC 17: 25,845,776 probably benign Het
Ythdf3 C T 3: 16,204,495 P280S probably damaging Het
Zbbx A G 3: 75,112,083 S107P probably benign Het
Zdhhc7 A T 8: 120,086,686 V128E probably benign Het
Zfp235 A G 7: 24,142,126 S657G probably damaging Het
Zfp84 G A 7: 29,776,872 E330K probably damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150408709 missense unknown
R8528:Zfp442 UTSW 2 150409042 missense probably damaging 1.00
R9110:Zfp442 UTSW 2 150408173 missense probably benign 0.30
R9269:Zfp442 UTSW 2 150409367 missense probably benign 0.19
R9371:Zfp442 UTSW 2 150408756 missense unknown
R9459:Zfp442 UTSW 2 150408748 missense unknown
R9711:Zfp442 UTSW 2 150408287 missense possibly damaging 0.93
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTCTCCAGTATGCGTTCTTTGATA -3'
(R):5'- CAGCCCATTGTGAAGGTGA -3'

Sequencing Primer
(F):5'- CTGTGTTGTGCAAAGTCAGTACCAC -3'
(R):5'- CCAATTATCTTTGCAGGCA -3'
Posted On 2022-05-16