Incidental Mutation 'R9401:Vmn2r116'
ID 711252
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Name vomeronasal 2, receptor 116
Synonyms V2Rp5, EG619697
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R9401 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23384803-23401864 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23401592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 767 (S767P)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
AlphaFold E9Q6I0
Predicted Effect probably damaging
Transcript: ENSMUST00000164856
AA Change: S767P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: S767P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,198 T603A probably benign Het
Aars A G 8: 111,054,153 D850G probably benign Het
Abcc9 T A 6: 142,598,110 T1480S possibly damaging Het
Adgrb3 C A 1: 25,553,702 V335F probably damaging Het
Agfg1 C A 1: 82,882,237 A275D probably benign Het
Alms1 T A 6: 85,678,019 C2713* probably null Het
Atp8a1 G A 5: 67,749,149 A474V Het
Baz1a C A 12: 54,916,554 S918I probably damaging Het
Bcl2l12 G T 7: 44,994,250 T120K possibly damaging Het
Bcl6 G T 16: 23,972,357 Q416K possibly damaging Het
Cdhr1 T A 14: 37,098,098 I16F probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cilp T C 9: 65,278,099 V492A probably damaging Het
Crim1 CCGC CC 17: 78,350,865 probably null Het
Ctcfl T G 2: 173,106,088 T479P probably damaging Het
Dlx6 A C 6: 6,863,581 M68L probably benign Het
Dnah7a C A 1: 53,528,867 V1857F probably benign Het
Dpy19l4 A G 4: 11,265,806 V714A probably benign Het
Elovl7 T A 13: 108,282,654 N273K probably benign Het
Fbxo22 A G 9: 55,223,344 K299R probably benign Het
Fig4 A G 10: 41,267,737 V242A probably benign Het
Fmo9 A T 1: 166,677,620 M68K probably damaging Het
Fry T A 5: 150,378,938 Y537N probably damaging Het
Fryl C T 5: 73,065,220 W2006* probably null Het
Fzd8 T A 18: 9,213,205 C96S possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm4450 T G 3: 98,456,503 T9P probably damaging Het
Gspt1 T C 16: 11,232,671 D272G possibly damaging Het
Gzmf A T 14: 56,211,356 M1K probably null Het
Hipk1 T C 3: 103,777,979 T107A probably benign Het
Ighe C T 12: 113,269,487 C438Y Het
Igkv4-50 T A 6: 69,700,983 R46W Het
Igsf3 T A 3: 101,425,759 Y118N probably damaging Het
Ispd T C 12: 36,502,074 V309A probably benign Het
Itsn1 T A 16: 91,815,520 Y266N probably damaging Het
Jph3 A G 8: 121,785,115 E614G probably damaging Het
Klk1b8 T A 7: 43,954,250 D170E probably benign Het
Ly6e A T 15: 74,958,304 K36* probably null Het
Map3k6 C A 4: 133,241,156 A23E probably damaging Het
Med13l T A 5: 118,745,024 M1316K probably benign Het
Olfr1038-ps A T 2: 86,122,024 I34F possibly damaging Het
Olfr368 T C 2: 37,332,281 V178A possibly damaging Het
Olfr813 A G 10: 129,857,429 R304G probably benign Het
Pih1d2 T A 9: 50,618,605 C45S probably damaging Het
Pik3r2 G A 8: 70,771,093 S318L possibly damaging Het
Pknox1 T C 17: 31,583,778 I9T probably benign Het
Pknox2 T C 9: 36,923,745 I143V probably damaging Het
Polr1d A G 5: 147,078,678 Y57C probably damaging Het
Pum3 A T 19: 27,398,936 D527E probably benign Het
Rars2 T A 4: 34,654,819 H374Q probably damaging Het
Rassf9 G A 10: 102,512,508 probably benign Het
Rbl1 T A 2: 157,174,822 H619L possibly damaging Het
Scamp4 T C 10: 80,612,404 V153A probably benign Het
Sec23b T G 2: 144,578,366 I450S probably benign Het
Slc35b2 A G 17: 45,566,984 I297V probably benign Het
Slc4a4 C T 5: 89,179,666 T654I probably damaging Het
Slc6a5 T A 7: 49,951,437 M662K probably damaging Het
Smarcad1 T C 6: 65,094,337 Y589H probably benign Het
Stab1 A T 14: 31,161,112 F374I probably benign Het
Stat5a C T 11: 100,865,428 T158M possibly damaging Het
Trpc3 A T 3: 36,621,354 Y878* probably null Het
Ubr1 T A 2: 120,935,284 T491S probably benign Het
Uggt1 C T 1: 36,216,131 probably null Het
Ugt1a6a T A 1: 88,139,160 Y229* probably null Het
Vmn1r225 G A 17: 20,502,649 W117* probably null Het
Vmn1r225 A C 17: 20,502,650 K118Q probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Wdr90 AGAC AGACGAC 17: 25,845,776 probably benign Het
Ythdf3 C T 3: 16,204,495 P280S probably damaging Het
Zbbx A G 3: 75,112,083 S107P probably benign Het
Zdhhc7 A T 8: 120,086,686 V128E probably benign Het
Zfp235 A G 7: 24,142,126 S657G probably damaging Het
Zfp442 T A 2: 150,409,695 I96F possibly damaging Het
Zfp84 G A 7: 29,776,872 E330K probably damaging Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 splice site probably benign
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 splice site probably benign
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23388947 missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site probably benign
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23386051 missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4298:Vmn2r116 UTSW 17 23401827 missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23386804 missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23397719 missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23388831 nonsense probably null
R6667:Vmn2r116 UTSW 17 23401092 missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23386125 missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23384856 splice site probably null
R7940:Vmn2r116 UTSW 17 23386972 missense probably damaging 0.99
R8510:Vmn2r116 UTSW 17 23385931 nonsense probably null
R8950:Vmn2r116 UTSW 17 23401493 missense probably damaging 1.00
R8956:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R8977:Vmn2r116 UTSW 17 23386942 missense possibly damaging 0.56
R9030:Vmn2r116 UTSW 17 23384890 missense possibly damaging 0.82
R9077:Vmn2r116 UTSW 17 23385982 missense probably benign 0.14
R9223:Vmn2r116 UTSW 17 23401167 missense probably damaging 1.00
R9449:Vmn2r116 UTSW 17 23386945 missense probably benign 0.01
S24628:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23401428 missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23388892 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGGGCAATTAACTACATCATTC -3'
(R):5'- GGGACAAAGATGCATCCCAG -3'

Sequencing Primer
(F):5'- CATCCAAGTTATTGTATGTGCAGTC -3'
(R):5'- GCATCCCAGCATCCCTG -3'
Posted On 2022-05-16