Incidental Mutation 'R9402:Phf3'
ID 711259
Institutional Source Beutler Lab
Gene Symbol Phf3
Ensembl Gene ENSMUSG00000048874
Gene Name PHD finger protein 3
Synonyms AU020177, 2310061N19Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9402 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 30841417-30912989 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 30850928 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1142 (T1142M)
Ref Sequence ENSEMBL: ENSMUSP00000139610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000191329]
AlphaFold B2RQG2
Predicted Effect probably damaging
Transcript: ENSMUST00000088310
AA Change: T1142M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: T1142M

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186105
Predicted Effect probably damaging
Transcript: ENSMUST00000186733
AA Change: T1142M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: T1142M

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191245
Predicted Effect probably benign
Transcript: ENSMUST00000191329
SMART Domains Protein: ENSMUSP00000139662
Gene: ENSMUSG00000048874

DomainStartEndE-ValueType
Pfam:SPOC 1 88 1.9e-17 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,049,154 (GRCm39) Q218L probably benign Het
Atg2b A G 12: 105,614,682 (GRCm39) F1083S probably damaging Het
Bche T C 3: 73,608,656 (GRCm39) N257D probably benign Het
Cfap221 T A 1: 119,860,551 (GRCm39) M692L probably benign Het
Cfap46 G T 7: 139,215,865 (GRCm39) P1530Q unknown Het
Crim1 CCGC CC 17: 78,658,294 (GRCm39) probably null Het
Cyp4f39 T C 17: 32,710,183 (GRCm39) probably null Het
Daam1 A G 12: 72,006,604 (GRCm39) T674A probably benign Het
Elp2 A T 18: 24,759,220 (GRCm39) I526L probably benign Het
Exoc4 T A 6: 33,453,078 (GRCm39) *523K probably null Het
Fbxl7 G A 15: 26,552,589 (GRCm39) S226L probably damaging Het
Fbxl9 T A 8: 106,049,988 (GRCm39) Y12F probably benign Het
Fry G A 5: 150,357,161 (GRCm39) E1903K possibly damaging Het
Fry G A 5: 150,360,318 (GRCm39) R1988K probably damaging Het
Gas1 A T 13: 60,324,016 (GRCm39) M206K probably damaging Het
Gbp10 T A 5: 105,381,863 (GRCm39) T96S possibly damaging Het
Gm14569 G A X: 35,694,549 (GRCm39) P1387S probably damaging Het
Gpaa1 A G 15: 76,216,418 (GRCm39) T105A probably benign Het
Hoxc13 C A 15: 102,830,051 (GRCm39) C143* probably null Het
Htt T C 5: 35,006,324 (GRCm39) I1411T probably damaging Het
Inava T G 1: 136,155,348 (GRCm39) S86R probably benign Het
Jmy C T 13: 93,635,678 (GRCm39) C46Y probably damaging Het
Klhl40 A G 9: 121,609,482 (GRCm39) Y453C possibly damaging Het
Krit1 T A 5: 3,872,210 (GRCm39) Y460N possibly damaging Het
Lamb3 C A 1: 193,013,704 (GRCm39) T526K Het
Luzp1 T A 4: 136,270,493 (GRCm39) H905Q probably damaging Het
Lyst T A 13: 13,812,463 (GRCm39) H958Q probably benign Het
Magi1 T C 6: 94,260,278 (GRCm39) N9S probably benign Het
Mmadhc A T 2: 50,171,119 (GRCm39) V231E probably benign Het
Muc5b T A 7: 141,399,151 (GRCm39) M364K unknown Het
Nae1 A G 8: 105,254,817 (GRCm39) probably null Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Nlgn2 A G 11: 69,718,933 (GRCm39) F252S Het
Nlrp9a A T 7: 26,270,030 (GRCm39) N874I possibly damaging Het
Nodal T C 10: 61,259,379 (GRCm39) I272T probably damaging Het
Or4a15 C A 2: 89,193,123 (GRCm39) G217* probably null Het
Or4c12 A T 2: 89,774,284 (GRCm39) Y58* probably null Het
Or51a24 G A 7: 103,733,610 (GRCm39) R226* probably null Het
Or52ab4 T C 7: 102,988,196 (GRCm39) S312P probably benign Het
Orm1 C A 4: 63,263,369 (GRCm39) Q61K possibly damaging Het
Pcdh17 T C 14: 84,684,646 (GRCm39) V371A probably damaging Het
Pcdhb19 C T 18: 37,632,532 (GRCm39) Q776* probably null Het
Phf14 A G 6: 11,933,779 (GRCm39) R214G possibly damaging Het
Pigz A G 16: 31,764,187 (GRCm39) E415G probably damaging Het
Pramel5 T C 4: 143,998,026 (GRCm39) T406A probably benign Het
Prtg A G 9: 72,819,253 (GRCm39) E1082G probably benign Het
Rtp3 A G 9: 110,815,031 (GRCm39) C445R unknown Het
Scn3b A T 9: 40,193,852 (GRCm39) E193V probably damaging Het
Scn7a A T 2: 66,510,456 (GRCm39) N1315K probably damaging Het
Snx14 C T 9: 88,289,490 (GRCm39) G254D probably damaging Het
Srbd1 T C 17: 86,406,705 (GRCm39) D560G probably benign Het
Srp72 T A 5: 77,124,329 (GRCm39) L65* probably null Het
Steap1 T A 5: 5,790,664 (GRCm39) I95F Het
Taf3 A G 2: 9,955,923 (GRCm39) probably null Het
Taok2 T C 7: 126,469,400 (GRCm39) N1143D Het
Tas2r114 C T 6: 131,666,894 (GRCm39) G45S possibly damaging Het
Tcerg1l T C 7: 137,811,551 (GRCm39) K548E probably damaging Het
Tcp1 T A 17: 13,141,505 (GRCm39) L328Q probably benign Het
Tns2 A G 15: 102,021,623 (GRCm39) H1096R probably damaging Het
Trps1 A T 15: 50,709,652 (GRCm39) Y233N probably damaging Het
Tubgcp6 A G 15: 88,987,064 (GRCm39) V1303A probably benign Het
Ugt1a2 T C 1: 88,128,684 (GRCm39) F109S possibly damaging Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Zfp748 A G 13: 67,693,511 (GRCm39) V54A probably benign Het
Other mutations in Phf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Phf3 APN 1 30,850,928 (GRCm39) missense probably damaging 0.99
IGL00704:Phf3 APN 1 30,843,919 (GRCm39) missense probably benign
IGL01147:Phf3 APN 1 30,843,250 (GRCm39) missense probably damaging 1.00
IGL01360:Phf3 APN 1 30,847,809 (GRCm39) missense probably damaging 1.00
IGL01376:Phf3 APN 1 30,869,566 (GRCm39) missense possibly damaging 0.62
IGL01396:Phf3 APN 1 30,843,386 (GRCm39) nonsense probably null
IGL01830:Phf3 APN 1 30,853,148 (GRCm39) nonsense probably null
IGL02108:Phf3 APN 1 30,869,032 (GRCm39) missense probably damaging 1.00
IGL02156:Phf3 APN 1 30,847,859 (GRCm39) missense probably damaging 1.00
IGL02576:Phf3 APN 1 30,869,117 (GRCm39) missense probably benign 0.01
IGL03031:Phf3 APN 1 30,843,734 (GRCm39) missense probably benign 0.00
IGL03334:Phf3 APN 1 30,844,810 (GRCm39) missense probably damaging 0.99
IGL03411:Phf3 APN 1 30,843,482 (GRCm39) missense probably damaging 1.00
FR4976:Phf3 UTSW 1 30,844,104 (GRCm39) utr 3 prime probably benign
PIT4458001:Phf3 UTSW 1 30,855,622 (GRCm39) missense probably damaging 1.00
R0037:Phf3 UTSW 1 30,843,999 (GRCm39) missense probably benign 0.03
R0052:Phf3 UTSW 1 30,847,848 (GRCm39) missense probably damaging 1.00
R0114:Phf3 UTSW 1 30,844,524 (GRCm39) missense possibly damaging 0.87
R0123:Phf3 UTSW 1 30,844,146 (GRCm39) missense probably benign 0.01
R0225:Phf3 UTSW 1 30,844,146 (GRCm39) missense probably benign 0.01
R0715:Phf3 UTSW 1 30,850,919 (GRCm39) missense probably damaging 1.00
R0835:Phf3 UTSW 1 30,869,632 (GRCm39) missense probably benign 0.02
R0848:Phf3 UTSW 1 30,902,253 (GRCm39) missense probably damaging 1.00
R1473:Phf3 UTSW 1 30,845,021 (GRCm39) missense probably damaging 1.00
R1522:Phf3 UTSW 1 30,844,729 (GRCm39) missense probably benign 0.05
R1549:Phf3 UTSW 1 30,843,923 (GRCm39) missense probably benign 0.00
R1555:Phf3 UTSW 1 30,844,958 (GRCm39) missense possibly damaging 0.86
R1780:Phf3 UTSW 1 30,851,023 (GRCm39) missense probably damaging 1.00
R1789:Phf3 UTSW 1 30,845,287 (GRCm39) missense probably damaging 1.00
R1875:Phf3 UTSW 1 30,869,704 (GRCm39) missense possibly damaging 0.81
R1912:Phf3 UTSW 1 30,843,426 (GRCm39) missense probably damaging 1.00
R1957:Phf3 UTSW 1 30,870,601 (GRCm39) missense probably damaging 1.00
R2019:Phf3 UTSW 1 30,850,928 (GRCm39) missense probably damaging 0.99
R2259:Phf3 UTSW 1 30,843,424 (GRCm39) missense probably benign 0.20
R2305:Phf3 UTSW 1 30,844,556 (GRCm39) nonsense probably null
R2345:Phf3 UTSW 1 30,844,432 (GRCm39) nonsense probably null
R2424:Phf3 UTSW 1 30,845,430 (GRCm39) missense probably damaging 1.00
R2497:Phf3 UTSW 1 30,869,095 (GRCm39) missense probably damaging 1.00
R2504:Phf3 UTSW 1 30,849,870 (GRCm39) missense probably damaging 1.00
R3522:Phf3 UTSW 1 30,844,684 (GRCm39) missense probably damaging 1.00
R3816:Phf3 UTSW 1 30,844,834 (GRCm39) missense probably damaging 1.00
R4152:Phf3 UTSW 1 30,870,539 (GRCm39) missense probably benign 0.13
R4403:Phf3 UTSW 1 30,843,490 (GRCm39) missense probably damaging 1.00
R4658:Phf3 UTSW 1 30,902,169 (GRCm39) missense probably damaging 1.00
R4663:Phf3 UTSW 1 30,860,296 (GRCm39) missense probably damaging 1.00
R4669:Phf3 UTSW 1 30,869,027 (GRCm39) missense probably damaging 1.00
R4706:Phf3 UTSW 1 30,844,687 (GRCm39) missense probably damaging 1.00
R4757:Phf3 UTSW 1 30,859,908 (GRCm39) missense probably damaging 1.00
R4766:Phf3 UTSW 1 30,853,020 (GRCm39) unclassified probably benign
R4786:Phf3 UTSW 1 30,855,638 (GRCm39) nonsense probably null
R5107:Phf3 UTSW 1 30,870,566 (GRCm39) missense probably benign 0.03
R5155:Phf3 UTSW 1 30,863,457 (GRCm39) missense possibly damaging 0.87
R5310:Phf3 UTSW 1 30,842,887 (GRCm39) missense probably damaging 1.00
R5823:Phf3 UTSW 1 30,843,764 (GRCm39) missense probably damaging 1.00
R5944:Phf3 UTSW 1 30,859,785 (GRCm39) missense probably damaging 1.00
R5979:Phf3 UTSW 1 30,844,827 (GRCm39) missense probably damaging 1.00
R6007:Phf3 UTSW 1 30,843,426 (GRCm39) missense probably damaging 1.00
R6024:Phf3 UTSW 1 30,902,307 (GRCm39) missense probably damaging 1.00
R6072:Phf3 UTSW 1 30,869,769 (GRCm39) missense probably benign 0.08
R6533:Phf3 UTSW 1 30,845,399 (GRCm39) missense probably damaging 1.00
R6649:Phf3 UTSW 1 30,844,104 (GRCm39) missense possibly damaging 0.75
R6653:Phf3 UTSW 1 30,844,104 (GRCm39) missense possibly damaging 0.75
R6852:Phf3 UTSW 1 30,843,711 (GRCm39) missense probably damaging 0.97
R6855:Phf3 UTSW 1 30,859,204 (GRCm39) missense probably damaging 1.00
R6862:Phf3 UTSW 1 30,853,063 (GRCm39) missense probably damaging 1.00
R6930:Phf3 UTSW 1 30,850,958 (GRCm39) missense probably damaging 1.00
R7135:Phf3 UTSW 1 30,870,190 (GRCm39) missense possibly damaging 0.61
R7323:Phf3 UTSW 1 30,852,211 (GRCm39) missense probably benign 0.01
R7352:Phf3 UTSW 1 30,843,407 (GRCm39) missense possibly damaging 0.87
R7455:Phf3 UTSW 1 30,876,239 (GRCm39) missense probably damaging 0.96
R7549:Phf3 UTSW 1 30,870,556 (GRCm39) missense probably benign 0.01
R7609:Phf3 UTSW 1 30,844,582 (GRCm39) missense probably benign 0.05
R7720:Phf3 UTSW 1 30,868,938 (GRCm39) missense probably damaging 1.00
R7745:Phf3 UTSW 1 30,843,305 (GRCm39) missense probably damaging 1.00
R8134:Phf3 UTSW 1 30,863,552 (GRCm39) missense unknown
R8264:Phf3 UTSW 1 30,870,138 (GRCm39) missense possibly damaging 0.48
R8545:Phf3 UTSW 1 30,863,391 (GRCm39) missense possibly damaging 0.48
R8821:Phf3 UTSW 1 30,860,347 (GRCm39) nonsense probably null
R8831:Phf3 UTSW 1 30,860,347 (GRCm39) nonsense probably null
R8873:Phf3 UTSW 1 30,843,773 (GRCm39) missense possibly damaging 0.74
R9101:Phf3 UTSW 1 30,843,026 (GRCm39) missense possibly damaging 0.56
R9426:Phf3 UTSW 1 30,870,625 (GRCm39) nonsense probably null
R9594:Phf3 UTSW 1 30,869,003 (GRCm39) missense probably benign 0.07
R9707:Phf3 UTSW 1 30,868,923 (GRCm39) critical splice donor site probably null
R9803:Phf3 UTSW 1 30,869,872 (GRCm39) missense probably benign 0.16
Z1177:Phf3 UTSW 1 30,851,049 (GRCm39) critical splice acceptor site probably null
Z1177:Phf3 UTSW 1 30,844,132 (GRCm39) missense unknown
Z1177:Phf3 UTSW 1 30,843,376 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTCCTGTTCACTTATCCATTG -3'
(R):5'- GCATGACAGTGTAAAACTTGCAG -3'

Sequencing Primer
(F):5'- GCCTGGGGTATACATAGTCAC -3'
(R):5'- TGACAGTGTAAAACTTGCAGATAAC -3'
Posted On 2022-05-16