Mutagenetix > Incidental Mutation

Incidental Mutation 'R9402:Phf3'

711259

Institutional Source

Beutler Lab

Gene Symbol

Phf3

Ensembl Gene

ENSMUSG00000048874

Gene Name

PHD finger protein 3

Synonyms

AU020177, 2310061N19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9402 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30802339-30873921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 30811847 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 1142 (T1142M)

Ref Sequence

ENSEMBL: ENSMUSP00000139610 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000191329]

AlphaFold

B2RQG2

Predicted Effect

probably damaging
Transcript: ENSMUST00000088310
AA Change: T1142M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: T1142M

Domain	Start	End	E-Value	Type
low complexity region	212	223	N/A	INTRINSIC
low complexity region	337	344	N/A	INTRINSIC
low complexity region	600	611	N/A	INTRINSIC
low complexity region	651	660	N/A	INTRINSIC
PHD	697	748	3.82e-10	SMART
low complexity region	847	859	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
TFS2M	908	1008	1.28e-47	SMART
Pfam:SPOC	1188	1294	4.2e-26	PFAM
low complexity region	1367	1373	N/A	INTRINSIC
low complexity region	1516	1529	N/A	INTRINSIC
low complexity region	1597	1620	N/A	INTRINSIC
low complexity region	1796	1811	N/A	INTRINSIC
low complexity region	1813	1846	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186105

Predicted Effect

probably damaging
Transcript: ENSMUST00000186733
AA Change: T1142M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: T1142M

Domain	Start	End	E-Value	Type
low complexity region	212	223	N/A	INTRINSIC
low complexity region	337	344	N/A	INTRINSIC
low complexity region	600	611	N/A	INTRINSIC
low complexity region	651	660	N/A	INTRINSIC
PHD	697	748	3.82e-10	SMART
low complexity region	847	859	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
TFS2M	908	1008	1.28e-47	SMART
Pfam:SPOC	1188	1294	4.2e-26	PFAM
low complexity region	1367	1373	N/A	INTRINSIC
low complexity region	1516	1529	N/A	INTRINSIC
low complexity region	1597	1620	N/A	INTRINSIC
low complexity region	1796	1811	N/A	INTRINSIC
low complexity region	1813	1846	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187316

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191245

Predicted Effect

probably benign
Transcript: ENSMUST00000191329

SMART Domains

Protein: ENSMUSP00000139662
Gene: ENSMUSG00000048874

Domain	Start	End	E-Value	Type
Pfam:SPOC	1	88	1.9e-17	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	G	1: 136,227,610	S86R	probably benign	Het
Abca9	T	A	11: 110,158,328	Q218L	probably benign	Het
Atg2b	A	G	12: 105,648,423	F1083S	probably damaging	Het
Bche	T	C	3: 73,701,323	N257D	probably benign	Het
Cfap221	T	A	1: 119,932,821	M692L	probably benign	Het
Cfap46	G	T	7: 139,635,949	P1530Q	unknown	Het
Crim1	CCGC	CC	17: 78,350,865		probably null	Het
Cyp4f39	T	C	17: 32,491,209		probably null	Het
Daam1	A	G	12: 71,959,830	T674A	probably benign	Het
Elp2	A	T	18: 24,626,163	I526L	probably benign	Het
Exoc4	T	A	6: 33,476,143	*523K	probably null	Het
Fbxl7	G	A	15: 26,552,503	S226L	probably damaging	Het
Fry	G	A	5: 150,433,696	E1903K	possibly damaging	Het
Fry	G	A	5: 150,436,853	R1988K	probably damaging	Het
Gas1	A	T	13: 60,176,202	M206K	probably damaging	Het
Gbp10	T	A	5: 105,233,997	T96S	possibly damaging	Het
Gm14569	G	A	X: 36,430,896	P1387S	probably damaging	Het
Gpaa1	A	G	15: 76,332,218	T105A	probably benign	Het
Hoxc13	C	A	15: 102,921,616	C143*	probably null	Het
Htt	T	C	5: 34,848,980	I1411T	probably damaging	Het
Jmy	C	T	13: 93,499,170	C46Y	probably damaging	Het
Klhl40	A	G	9: 121,780,416	Y453C	possibly damaging	Het
Krit1	T	A	5: 3,822,210	Y460N	possibly damaging	Het
Lamb3	C	A	1: 193,331,396	T526K		Het
Lrrc29	T	A	8: 105,323,356	Y12F	probably benign	Het
Luzp1	T	A	4: 136,543,182	H905Q	probably damaging	Het
Lyst	T	A	13: 13,637,878	H958Q	probably benign	Het
Magi1	T	C	6: 94,283,297	N9S	probably benign	Het
Mmadhc	A	T	2: 50,281,107	V231E	probably benign	Het
Muc5b	T	A	7: 141,845,414	M364K	unknown	Het
Nae1	A	G	8: 104,528,185		probably null	Het
Ndst4	C	T	3: 125,724,736	S354L	probably benign	Het
Nlgn2	A	G	11: 69,828,107	F252S		Het
Nlrp9a	A	T	7: 26,570,605	N874I	possibly damaging	Het
Nodal	T	C	10: 61,423,600	I272T	probably damaging	Het
Olfr1234	C	A	2: 89,362,779	G217*	probably null	Het
Olfr1259	A	T	2: 89,943,940	Y58*	probably null	Het
Olfr599	T	C	7: 103,338,989	S312P	probably benign	Het
Olfr645	G	A	7: 104,084,403	R226*	probably null	Het
Orm1	C	A	4: 63,345,132	Q61K	possibly damaging	Het
Pcdh17	T	C	14: 84,447,206	V371A	probably damaging	Het
Pcdhb19	C	T	18: 37,499,479	Q776*	probably null	Het
Phf14	A	G	6: 11,933,780	R214G	possibly damaging	Het
Pigz	A	G	16: 31,945,369	E415G	probably damaging	Het
Pramel5	T	C	4: 144,271,456	T406A	probably benign	Het
Prtg	A	G	9: 72,911,971	E1082G	probably benign	Het
Rtp3	A	G	9: 110,985,963	C445R	unknown	Het
Scn3b	A	T	9: 40,282,556	E193V	probably damaging	Het
Scn7a	A	T	2: 66,680,112	N1315K	probably damaging	Het
Snx14	C	T	9: 88,407,437	G254D	probably damaging	Het
Srbd1	T	C	17: 86,099,277	D560G	probably benign	Het
Srp72	T	A	5: 76,976,482	L65*	probably null	Het
Steap1	T	A	5: 5,740,664	I95F		Het
Taf3	A	G	2: 9,951,112		probably null	Het
Taok2	T	C	7: 126,870,228	N1143D		Het
Tas2r114	C	T	6: 131,689,931	G45S	possibly damaging	Het
Tcerg1l	T	C	7: 138,209,822	K548E	probably damaging	Het
Tcp1	T	A	17: 12,922,618	L328Q	probably benign	Het
Tns2	A	G	15: 102,113,188	H1096R	probably damaging	Het
Trps1	A	T	15: 50,846,256	Y233N	probably damaging	Het
Tubgcp6	A	G	15: 89,102,861	V1303A	probably benign	Het
Ugt1a2	T	C	1: 88,200,962	F109S	possibly damaging	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Zfp748	A	G	13: 67,545,392	V54A	probably benign	Het

Other mutations in Phf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Phf3	APN	1	30811847	missense	probably damaging	0.99
IGL00704:Phf3	APN	1	30804838	missense	probably benign
IGL01147:Phf3	APN	1	30804169	missense	probably damaging	1.00
IGL01360:Phf3	APN	1	30808728	missense	probably damaging	1.00
IGL01376:Phf3	APN	1	30830485	missense	possibly damaging	0.62
IGL01396:Phf3	APN	1	30804305	nonsense	probably null
IGL01830:Phf3	APN	1	30814067	nonsense	probably null
IGL02108:Phf3	APN	1	30829951	missense	probably damaging	1.00
IGL02156:Phf3	APN	1	30808778	missense	probably damaging	1.00
IGL02576:Phf3	APN	1	30830036	missense	probably benign	0.01
IGL03031:Phf3	APN	1	30804653	missense	probably benign	0.00
IGL03334:Phf3	APN	1	30805729	missense	probably damaging	0.99
IGL03411:Phf3	APN	1	30804401	missense	probably damaging	1.00
FR4976:Phf3	UTSW	1	30805023	utr 3 prime	probably benign
PIT4458001:Phf3	UTSW	1	30816541	missense	probably damaging	1.00
R0037:Phf3	UTSW	1	30804918	missense	probably benign	0.03
R0052:Phf3	UTSW	1	30808767	missense	probably damaging	1.00
R0114:Phf3	UTSW	1	30805443	missense	possibly damaging	0.87
R0123:Phf3	UTSW	1	30805065	missense	probably benign	0.01
R0225:Phf3	UTSW	1	30805065	missense	probably benign	0.01
R0715:Phf3	UTSW	1	30811838	missense	probably damaging	1.00
R0835:Phf3	UTSW	1	30830551	missense	probably benign	0.02
R0848:Phf3	UTSW	1	30863172	missense	probably damaging	1.00
R1473:Phf3	UTSW	1	30805940	missense	probably damaging	1.00
R1522:Phf3	UTSW	1	30805648	missense	probably benign	0.05
R1549:Phf3	UTSW	1	30804842	missense	probably benign	0.00
R1555:Phf3	UTSW	1	30805877	missense	possibly damaging	0.86
R1780:Phf3	UTSW	1	30811942	missense	probably damaging	1.00
R1789:Phf3	UTSW	1	30806206	missense	probably damaging	1.00
R1875:Phf3	UTSW	1	30830623	missense	possibly damaging	0.81
R1912:Phf3	UTSW	1	30804345	missense	probably damaging	1.00
R1957:Phf3	UTSW	1	30831520	missense	probably damaging	1.00
R2019:Phf3	UTSW	1	30811847	missense	probably damaging	0.99
R2259:Phf3	UTSW	1	30804343	missense	probably benign	0.20
R2305:Phf3	UTSW	1	30805475	nonsense	probably null
R2345:Phf3	UTSW	1	30805351	nonsense	probably null
R2424:Phf3	UTSW	1	30806349	missense	probably damaging	1.00
R2497:Phf3	UTSW	1	30830014	missense	probably damaging	1.00
R2504:Phf3	UTSW	1	30810789	missense	probably damaging	1.00
R3522:Phf3	UTSW	1	30805603	missense	probably damaging	1.00
R3816:Phf3	UTSW	1	30805753	missense	probably damaging	1.00
R4152:Phf3	UTSW	1	30831458	missense	probably benign	0.13
R4403:Phf3	UTSW	1	30804409	missense	probably damaging	1.00
R4658:Phf3	UTSW	1	30863088	missense	probably damaging	1.00
R4663:Phf3	UTSW	1	30821215	missense	probably damaging	1.00
R4669:Phf3	UTSW	1	30829946	missense	probably damaging	1.00
R4706:Phf3	UTSW	1	30805606	missense	probably damaging	1.00
R4757:Phf3	UTSW	1	30820827	missense	probably damaging	1.00
R4766:Phf3	UTSW	1	30813939	unclassified	probably benign
R4786:Phf3	UTSW	1	30816557	nonsense	probably null
R5107:Phf3	UTSW	1	30831485	missense	probably benign	0.03
R5155:Phf3	UTSW	1	30824376	missense	possibly damaging	0.87
R5310:Phf3	UTSW	1	30803806	missense	probably damaging	1.00
R5823:Phf3	UTSW	1	30804683	missense	probably damaging	1.00
R5944:Phf3	UTSW	1	30820704	missense	probably damaging	1.00
R5979:Phf3	UTSW	1	30805746	missense	probably damaging	1.00
R6007:Phf3	UTSW	1	30804345	missense	probably damaging	1.00
R6024:Phf3	UTSW	1	30863226	missense	probably damaging	1.00
R6072:Phf3	UTSW	1	30830688	missense	probably benign	0.08
R6533:Phf3	UTSW	1	30806318	missense	probably damaging	1.00
R6649:Phf3	UTSW	1	30805023	missense	possibly damaging	0.75
R6653:Phf3	UTSW	1	30805023	missense	possibly damaging	0.75
R6852:Phf3	UTSW	1	30804630	missense	probably damaging	0.97
R6855:Phf3	UTSW	1	30820123	missense	probably damaging	1.00
R6862:Phf3	UTSW	1	30813982	missense	probably damaging	1.00
R6930:Phf3	UTSW	1	30811877	missense	probably damaging	1.00
R7135:Phf3	UTSW	1	30831109	missense	possibly damaging	0.61
R7323:Phf3	UTSW	1	30813130	missense	probably benign	0.01
R7352:Phf3	UTSW	1	30804326	missense	possibly damaging	0.87
R7455:Phf3	UTSW	1	30837158	missense	probably damaging	0.96
R7549:Phf3	UTSW	1	30831475	missense	probably benign	0.01
R7609:Phf3	UTSW	1	30805501	missense	probably benign	0.05
R7720:Phf3	UTSW	1	30829857	missense	probably damaging	1.00
R7745:Phf3	UTSW	1	30804224	missense	probably damaging	1.00
R8134:Phf3	UTSW	1	30824471	missense	unknown
R8264:Phf3	UTSW	1	30831057	missense	possibly damaging	0.48
R8545:Phf3	UTSW	1	30824310	missense	possibly damaging	0.48
R8821:Phf3	UTSW	1	30821266	nonsense	probably null
R8831:Phf3	UTSW	1	30821266	nonsense	probably null
R8873:Phf3	UTSW	1	30804692	missense	possibly damaging	0.74
R9101:Phf3	UTSW	1	30803945	missense	possibly damaging	0.56
R9426:Phf3	UTSW	1	30831544	nonsense	probably null
R9594:Phf3	UTSW	1	30829922	missense	probably benign	0.07
R9707:Phf3	UTSW	1	30829842	critical splice donor site	probably null
R9803:Phf3	UTSW	1	30830791	missense	probably benign	0.16
Z1177:Phf3	UTSW	1	30804295	missense	probably damaging	1.00
Z1177:Phf3	UTSW	1	30805051	missense	unknown
Z1177:Phf3	UTSW	1	30811968	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GAAGTCCTGTTCACTTATCCATTG -3'
(R):5'- GCATGACAGTGTAAAACTTGCAG -3'

Sequencing Primer
(F):5'- GCCTGGGGTATACATAGTCAC -3'
(R):5'- TGACAGTGTAAAACTTGCAGATAAC -3'

Posted On

2022-05-16