Incidental Mutation 'R9402:Scn7a'
ID 711266
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms 1110034K09Rik, NaG, Nav2, Nax, Nav2.3, Scn6a
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R9402 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 66503770-66615254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66510456 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1315 (N1315K)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect probably damaging
Transcript: ENSMUST00000042792
AA Change: N1315K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: N1315K

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,049,154 (GRCm39) Q218L probably benign Het
Atg2b A G 12: 105,614,682 (GRCm39) F1083S probably damaging Het
Bche T C 3: 73,608,656 (GRCm39) N257D probably benign Het
Cfap221 T A 1: 119,860,551 (GRCm39) M692L probably benign Het
Cfap46 G T 7: 139,215,865 (GRCm39) P1530Q unknown Het
Crim1 CCGC CC 17: 78,658,294 (GRCm39) probably null Het
Cyp4f39 T C 17: 32,710,183 (GRCm39) probably null Het
Daam1 A G 12: 72,006,604 (GRCm39) T674A probably benign Het
Elp2 A T 18: 24,759,220 (GRCm39) I526L probably benign Het
Exoc4 T A 6: 33,453,078 (GRCm39) *523K probably null Het
Fbxl7 G A 15: 26,552,589 (GRCm39) S226L probably damaging Het
Fbxl9 T A 8: 106,049,988 (GRCm39) Y12F probably benign Het
Fry G A 5: 150,357,161 (GRCm39) E1903K possibly damaging Het
Fry G A 5: 150,360,318 (GRCm39) R1988K probably damaging Het
Gas1 A T 13: 60,324,016 (GRCm39) M206K probably damaging Het
Gbp10 T A 5: 105,381,863 (GRCm39) T96S possibly damaging Het
Gm14569 G A X: 35,694,549 (GRCm39) P1387S probably damaging Het
Gpaa1 A G 15: 76,216,418 (GRCm39) T105A probably benign Het
Hoxc13 C A 15: 102,830,051 (GRCm39) C143* probably null Het
Htt T C 5: 35,006,324 (GRCm39) I1411T probably damaging Het
Inava T G 1: 136,155,348 (GRCm39) S86R probably benign Het
Jmy C T 13: 93,635,678 (GRCm39) C46Y probably damaging Het
Klhl40 A G 9: 121,609,482 (GRCm39) Y453C possibly damaging Het
Krit1 T A 5: 3,872,210 (GRCm39) Y460N possibly damaging Het
Lamb3 C A 1: 193,013,704 (GRCm39) T526K Het
Luzp1 T A 4: 136,270,493 (GRCm39) H905Q probably damaging Het
Lyst T A 13: 13,812,463 (GRCm39) H958Q probably benign Het
Magi1 T C 6: 94,260,278 (GRCm39) N9S probably benign Het
Mmadhc A T 2: 50,171,119 (GRCm39) V231E probably benign Het
Muc5b T A 7: 141,399,151 (GRCm39) M364K unknown Het
Nae1 A G 8: 105,254,817 (GRCm39) probably null Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Nlgn2 A G 11: 69,718,933 (GRCm39) F252S Het
Nlrp9a A T 7: 26,270,030 (GRCm39) N874I possibly damaging Het
Nodal T C 10: 61,259,379 (GRCm39) I272T probably damaging Het
Or4a15 C A 2: 89,193,123 (GRCm39) G217* probably null Het
Or4c12 A T 2: 89,774,284 (GRCm39) Y58* probably null Het
Or51a24 G A 7: 103,733,610 (GRCm39) R226* probably null Het
Or52ab4 T C 7: 102,988,196 (GRCm39) S312P probably benign Het
Orm1 C A 4: 63,263,369 (GRCm39) Q61K possibly damaging Het
Pcdh17 T C 14: 84,684,646 (GRCm39) V371A probably damaging Het
Pcdhb19 C T 18: 37,632,532 (GRCm39) Q776* probably null Het
Phf14 A G 6: 11,933,779 (GRCm39) R214G possibly damaging Het
Phf3 G A 1: 30,850,928 (GRCm39) T1142M probably damaging Het
Pigz A G 16: 31,764,187 (GRCm39) E415G probably damaging Het
Pramel5 T C 4: 143,998,026 (GRCm39) T406A probably benign Het
Prtg A G 9: 72,819,253 (GRCm39) E1082G probably benign Het
Rtp3 A G 9: 110,815,031 (GRCm39) C445R unknown Het
Scn3b A T 9: 40,193,852 (GRCm39) E193V probably damaging Het
Snx14 C T 9: 88,289,490 (GRCm39) G254D probably damaging Het
Srbd1 T C 17: 86,406,705 (GRCm39) D560G probably benign Het
Srp72 T A 5: 77,124,329 (GRCm39) L65* probably null Het
Steap1 T A 5: 5,790,664 (GRCm39) I95F Het
Taf3 A G 2: 9,955,923 (GRCm39) probably null Het
Taok2 T C 7: 126,469,400 (GRCm39) N1143D Het
Tas2r114 C T 6: 131,666,894 (GRCm39) G45S possibly damaging Het
Tcerg1l T C 7: 137,811,551 (GRCm39) K548E probably damaging Het
Tcp1 T A 17: 13,141,505 (GRCm39) L328Q probably benign Het
Tns2 A G 15: 102,021,623 (GRCm39) H1096R probably damaging Het
Trps1 A T 15: 50,709,652 (GRCm39) Y233N probably damaging Het
Tubgcp6 A G 15: 88,987,064 (GRCm39) V1303A probably benign Het
Ugt1a2 T C 1: 88,128,684 (GRCm39) F109S possibly damaging Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Zfp748 A G 13: 67,693,511 (GRCm39) V54A probably benign Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66,513,671 (GRCm39) splice site probably benign
IGL00432:Scn7a APN 2 66,572,326 (GRCm39) nonsense probably null
IGL00720:Scn7a APN 2 66,506,388 (GRCm39) missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00784:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00926:Scn7a APN 2 66,514,475 (GRCm39) missense probably benign 0.06
IGL00963:Scn7a APN 2 66,534,289 (GRCm39) splice site probably benign
IGL01099:Scn7a APN 2 66,514,582 (GRCm39) missense probably damaging 1.00
IGL01326:Scn7a APN 2 66,582,604 (GRCm39) missense probably benign 0.13
IGL01538:Scn7a APN 2 66,534,196 (GRCm39) missense probably benign
IGL01624:Scn7a APN 2 66,582,269 (GRCm39) missense probably benign 0.07
IGL01794:Scn7a APN 2 66,505,853 (GRCm39) missense probably benign
IGL02100:Scn7a APN 2 66,505,843 (GRCm39) makesense probably null
IGL02326:Scn7a APN 2 66,530,392 (GRCm39) missense probably benign 0.00
IGL02472:Scn7a APN 2 66,582,658 (GRCm39) missense probably damaging 1.00
IGL02528:Scn7a APN 2 66,530,519 (GRCm39) missense probably damaging 1.00
IGL02798:Scn7a APN 2 66,544,219 (GRCm39) missense probably benign 0.00
IGL03026:Scn7a APN 2 66,506,442 (GRCm39) missense probably damaging 0.99
IGL03071:Scn7a APN 2 66,530,291 (GRCm39) missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66,528,160 (GRCm39) missense probably benign 0.01
IGL03180:Scn7a APN 2 66,506,578 (GRCm39) missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66,506,304 (GRCm39) missense probably benign 0.00
alert UTSW 2 66,510,590 (GRCm39) nonsense probably null
glimmer UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
Uptick UTSW 2 66,530,393 (GRCm39) nonsense probably null
PIT4514001:Scn7a UTSW 2 66,514,523 (GRCm39) missense probably damaging 1.00
R0004:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66,544,381 (GRCm39) missense probably benign 0.04
R0230:Scn7a UTSW 2 66,556,628 (GRCm39) missense probably damaging 1.00
R0463:Scn7a UTSW 2 66,506,084 (GRCm39) missense probably benign 0.05
R0846:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66,510,639 (GRCm39) missense probably damaging 0.98
R1282:Scn7a UTSW 2 66,531,193 (GRCm39) missense probably damaging 0.98
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1501:Scn7a UTSW 2 66,530,507 (GRCm39) missense probably benign 0.37
R1672:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66,506,287 (GRCm39) missense probably damaging 0.99
R1712:Scn7a UTSW 2 66,535,447 (GRCm39) missense probably benign 0.05
R1758:Scn7a UTSW 2 66,531,231 (GRCm39) missense probably damaging 0.97
R1758:Scn7a UTSW 2 66,510,527 (GRCm39) missense probably benign 0.00
R1775:Scn7a UTSW 2 66,511,299 (GRCm39) missense probably benign 0.02
R1848:Scn7a UTSW 2 66,514,357 (GRCm39) critical splice donor site probably null
R1851:Scn7a UTSW 2 66,510,635 (GRCm39) missense probably benign
R1919:Scn7a UTSW 2 66,530,317 (GRCm39) missense probably damaging 1.00
R1932:Scn7a UTSW 2 66,506,446 (GRCm39) missense probably damaging 1.00
R1945:Scn7a UTSW 2 66,506,324 (GRCm39) missense probably damaging 1.00
R1970:Scn7a UTSW 2 66,514,633 (GRCm39) missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66,513,613 (GRCm39) missense probably damaging 0.99
R2008:Scn7a UTSW 2 66,518,091 (GRCm39) missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66,567,780 (GRCm39) missense probably damaging 1.00
R2113:Scn7a UTSW 2 66,506,312 (GRCm39) missense probably damaging 1.00
R2128:Scn7a UTSW 2 66,528,330 (GRCm39) missense probably damaging 0.99
R2163:Scn7a UTSW 2 66,506,300 (GRCm39) missense probably damaging 0.97
R2421:Scn7a UTSW 2 66,556,646 (GRCm39) splice site probably benign
R2446:Scn7a UTSW 2 66,523,002 (GRCm39) missense probably damaging 0.98
R2922:Scn7a UTSW 2 66,530,551 (GRCm39) splice site probably benign
R3015:Scn7a UTSW 2 66,530,240 (GRCm39) missense probably benign 0.08
R3034:Scn7a UTSW 2 66,513,152 (GRCm39) missense probably damaging 1.00
R3419:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3429:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3430:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3434:Scn7a UTSW 2 66,505,847 (GRCm39) missense probably benign 0.01
R3803:Scn7a UTSW 2 66,510,590 (GRCm39) nonsense probably null
R3831:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R3833:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R4017:Scn7a UTSW 2 66,572,329 (GRCm39) missense probably damaging 1.00
R4244:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4245:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4276:Scn7a UTSW 2 66,514,407 (GRCm39) missense probably damaging 0.97
R4307:Scn7a UTSW 2 66,506,099 (GRCm39) missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66,567,815 (GRCm39) missense probably damaging 1.00
R4353:Scn7a UTSW 2 66,506,780 (GRCm39) missense probably benign 0.00
R4721:Scn7a UTSW 2 66,514,529 (GRCm39) missense probably damaging 1.00
R4722:Scn7a UTSW 2 66,531,228 (GRCm39) missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66,534,104 (GRCm39) missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66,556,592 (GRCm39) missense probably damaging 1.00
R5362:Scn7a UTSW 2 66,530,342 (GRCm39) missense probably damaging 1.00
R5437:Scn7a UTSW 2 66,506,690 (GRCm39) missense probably damaging 1.00
R5729:Scn7a UTSW 2 66,572,301 (GRCm39) critical splice donor site probably null
R5777:Scn7a UTSW 2 66,522,913 (GRCm39) missense probably damaging 1.00
R5785:Scn7a UTSW 2 66,527,912 (GRCm39) missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
R5830:Scn7a UTSW 2 66,544,395 (GRCm39) nonsense probably null
R5877:Scn7a UTSW 2 66,530,217 (GRCm39) nonsense probably null
R5881:Scn7a UTSW 2 66,505,870 (GRCm39) missense probably benign 0.01
R5967:Scn7a UTSW 2 66,506,057 (GRCm39) missense probably damaging 1.00
R5988:Scn7a UTSW 2 66,556,558 (GRCm39) nonsense probably null
R6077:Scn7a UTSW 2 66,527,940 (GRCm39) missense probably damaging 1.00
R6135:Scn7a UTSW 2 66,534,244 (GRCm39) missense probably benign
R6242:Scn7a UTSW 2 66,531,110 (GRCm39) missense probably benign 0.00
R6264:Scn7a UTSW 2 66,505,870 (GRCm39) missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66,530,458 (GRCm39) missense probably damaging 0.98
R6544:Scn7a UTSW 2 66,514,444 (GRCm39) missense probably damaging 1.00
R6770:Scn7a UTSW 2 66,559,528 (GRCm39) splice site probably null
R6997:Scn7a UTSW 2 66,534,147 (GRCm39) missense probably damaging 1.00
R7014:Scn7a UTSW 2 66,572,303 (GRCm39) missense probably null 1.00
R7126:Scn7a UTSW 2 66,587,630 (GRCm39) missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66,530,537 (GRCm39) missense probably benign 0.14
R7176:Scn7a UTSW 2 66,506,632 (GRCm39) missense probably damaging 1.00
R7185:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66,587,506 (GRCm39) missense probably damaging 1.00
R7332:Scn7a UTSW 2 66,522,898 (GRCm39) nonsense probably null
R7421:Scn7a UTSW 2 66,505,876 (GRCm39) missense probably benign 0.07
R7488:Scn7a UTSW 2 66,587,574 (GRCm39) missense probably benign 0.16
R7636:Scn7a UTSW 2 66,574,172 (GRCm39) missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66,506,536 (GRCm39) missense probably damaging 1.00
R7711:Scn7a UTSW 2 66,531,221 (GRCm39) missense probably damaging 1.00
R7813:Scn7a UTSW 2 66,506,689 (GRCm39) missense probably damaging 1.00
R7833:Scn7a UTSW 2 66,506,494 (GRCm39) missense probably damaging 1.00
R7914:Scn7a UTSW 2 66,530,294 (GRCm39) missense probably damaging 0.97
R7953:Scn7a UTSW 2 66,587,670 (GRCm39) missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66,506,173 (GRCm39) missense probably damaging 1.00
R8061:Scn7a UTSW 2 66,522,938 (GRCm39) missense probably damaging 1.00
R8121:Scn7a UTSW 2 66,531,203 (GRCm39) missense probably damaging 1.00
R8172:Scn7a UTSW 2 66,506,191 (GRCm39) missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66,506,318 (GRCm39) missense probably damaging 1.00
R8431:Scn7a UTSW 2 66,534,164 (GRCm39) missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66,574,041 (GRCm39) splice site probably benign
R8745:Scn7a UTSW 2 66,510,526 (GRCm39) missense probably benign
R8781:Scn7a UTSW 2 66,567,775 (GRCm39) missense probably benign 0.03
R8848:Scn7a UTSW 2 66,530,393 (GRCm39) nonsense probably null
R8878:Scn7a UTSW 2 66,506,199 (GRCm39) missense probably damaging 1.00
R8943:Scn7a UTSW 2 66,525,206 (GRCm39) synonymous silent
R8991:Scn7a UTSW 2 66,514,588 (GRCm39) missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9501:Scn7a UTSW 2 66,582,579 (GRCm39) missense probably benign 0.00
R9546:Scn7a UTSW 2 66,582,603 (GRCm39) missense possibly damaging 0.93
R9715:Scn7a UTSW 2 66,519,902 (GRCm39) missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66,520,026 (GRCm39) missense probably benign 0.01
X0066:Scn7a UTSW 2 66,510,536 (GRCm39) missense probably benign
Z1088:Scn7a UTSW 2 66,544,295 (GRCm39) missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66,582,613 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACGTAACGAGTTTGTGATAAC -3'
(R):5'- GACCTAGTAACACACCGTGTC -3'

Sequencing Primer
(F):5'- ACATAGTAATTGTACACACACACAG -3'
(R):5'- CCTAGTAACACACCGTGTCTTTAATG -3'
Posted On 2022-05-16