Incidental Mutation 'R9402:Krit1'
ID 711274
Institutional Source Beutler Lab
Gene Symbol Krit1
Ensembl Gene ENSMUSG00000000600
Gene Name KRIT1, ankyrin repeat containing
Synonyms A630036P20Rik, Krit1B, 2010007K12Rik, Ccm1, Krit1A, Krit1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9402 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 3853156-3894515 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3872210 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 460 (Y460N)
Ref Sequence ENSEMBL: ENSMUSP00000078985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080085] [ENSMUST00000171023] [ENSMUST00000200386] [ENSMUST00000200577]
AlphaFold Q6S5J6
Predicted Effect possibly damaging
Transcript: ENSMUST00000080085
AA Change: Y460N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078985
Gene: ENSMUSG00000000600
AA Change: Y460N

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 3.8e-88 PFAM
ANK 287 316 1.04e2 SMART
ANK 320 350 4.5e-3 SMART
ANK 354 382 1.17e-1 SMART
B41 416 640 1.39e-39 SMART
Blast:B41 673 702 6e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000171023
AA Change: Y460N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132375
Gene: ENSMUSG00000000600
AA Change: Y460N

DomainStartEndE-ValueType
PDB:4DX8|K 1 198 1e-125 PDB
ANK 287 316 1.04e2 SMART
ANK 320 350 4.5e-3 SMART
ANK 354 382 1.17e-1 SMART
B41 416 640 1.39e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200386
AA Change: Y412N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143559
Gene: ENSMUSG00000000600
AA Change: Y412N

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 8.1e-85 PFAM
ANK 306 334 7.5e-4 SMART
B41 368 592 9.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200577
SMART Domains Protein: ENSMUSP00000143776
Gene: ENSMUSG00000000600

DomainStartEndE-ValueType
Pfam:NUDIX_5 22 198 1.8e-85 PFAM
Blast:B41 200 329 1e-82 BLAST
SCOP:d1ycsb1 291 329 2e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing four ankyrin repeats, a band 4.1/ezrin/radixin/moesin (FERM) domain, and multiple NPXY sequences. The encoded protein is localized in the nucleus and cytoplasm. It binds to integrin cytoplasmic domain-associated protein-1 alpha (ICAP1alpha), and plays a critical role in beta1-integrin-mediated cell proliferation. It associates with junction proteins and RAS-related protein 1A (Rap1A), which requires the encoded protein for maintaining the integrity of endothelial junctions. It is also a microtubule-associated protein and may play a role in microtubule targeting. Mutations in this gene result in cerebral cavernous malformations. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Targeted disruption of this gene results in embryonic lethality by E11. Embryos display prominent vascular defects that disrupt arterial modeling and phenocopy the human disorder of cerebral cavernous malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,049,154 (GRCm39) Q218L probably benign Het
Atg2b A G 12: 105,614,682 (GRCm39) F1083S probably damaging Het
Bche T C 3: 73,608,656 (GRCm39) N257D probably benign Het
Cfap221 T A 1: 119,860,551 (GRCm39) M692L probably benign Het
Cfap46 G T 7: 139,215,865 (GRCm39) P1530Q unknown Het
Crim1 CCGC CC 17: 78,658,294 (GRCm39) probably null Het
Cyp4f39 T C 17: 32,710,183 (GRCm39) probably null Het
Daam1 A G 12: 72,006,604 (GRCm39) T674A probably benign Het
Elp2 A T 18: 24,759,220 (GRCm39) I526L probably benign Het
Exoc4 T A 6: 33,453,078 (GRCm39) *523K probably null Het
Fbxl7 G A 15: 26,552,589 (GRCm39) S226L probably damaging Het
Fbxl9 T A 8: 106,049,988 (GRCm39) Y12F probably benign Het
Fry G A 5: 150,357,161 (GRCm39) E1903K possibly damaging Het
Fry G A 5: 150,360,318 (GRCm39) R1988K probably damaging Het
Gas1 A T 13: 60,324,016 (GRCm39) M206K probably damaging Het
Gbp10 T A 5: 105,381,863 (GRCm39) T96S possibly damaging Het
Gm14569 G A X: 35,694,549 (GRCm39) P1387S probably damaging Het
Gpaa1 A G 15: 76,216,418 (GRCm39) T105A probably benign Het
Hoxc13 C A 15: 102,830,051 (GRCm39) C143* probably null Het
Htt T C 5: 35,006,324 (GRCm39) I1411T probably damaging Het
Inava T G 1: 136,155,348 (GRCm39) S86R probably benign Het
Jmy C T 13: 93,635,678 (GRCm39) C46Y probably damaging Het
Klhl40 A G 9: 121,609,482 (GRCm39) Y453C possibly damaging Het
Lamb3 C A 1: 193,013,704 (GRCm39) T526K Het
Luzp1 T A 4: 136,270,493 (GRCm39) H905Q probably damaging Het
Lyst T A 13: 13,812,463 (GRCm39) H958Q probably benign Het
Magi1 T C 6: 94,260,278 (GRCm39) N9S probably benign Het
Mmadhc A T 2: 50,171,119 (GRCm39) V231E probably benign Het
Muc5b T A 7: 141,399,151 (GRCm39) M364K unknown Het
Nae1 A G 8: 105,254,817 (GRCm39) probably null Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Nlgn2 A G 11: 69,718,933 (GRCm39) F252S Het
Nlrp9a A T 7: 26,270,030 (GRCm39) N874I possibly damaging Het
Nodal T C 10: 61,259,379 (GRCm39) I272T probably damaging Het
Or4a15 C A 2: 89,193,123 (GRCm39) G217* probably null Het
Or4c12 A T 2: 89,774,284 (GRCm39) Y58* probably null Het
Or51a24 G A 7: 103,733,610 (GRCm39) R226* probably null Het
Or52ab4 T C 7: 102,988,196 (GRCm39) S312P probably benign Het
Orm1 C A 4: 63,263,369 (GRCm39) Q61K possibly damaging Het
Pcdh17 T C 14: 84,684,646 (GRCm39) V371A probably damaging Het
Pcdhb19 C T 18: 37,632,532 (GRCm39) Q776* probably null Het
Phf14 A G 6: 11,933,779 (GRCm39) R214G possibly damaging Het
Phf3 G A 1: 30,850,928 (GRCm39) T1142M probably damaging Het
Pigz A G 16: 31,764,187 (GRCm39) E415G probably damaging Het
Pramel5 T C 4: 143,998,026 (GRCm39) T406A probably benign Het
Prtg A G 9: 72,819,253 (GRCm39) E1082G probably benign Het
Rtp3 A G 9: 110,815,031 (GRCm39) C445R unknown Het
Scn3b A T 9: 40,193,852 (GRCm39) E193V probably damaging Het
Scn7a A T 2: 66,510,456 (GRCm39) N1315K probably damaging Het
Snx14 C T 9: 88,289,490 (GRCm39) G254D probably damaging Het
Srbd1 T C 17: 86,406,705 (GRCm39) D560G probably benign Het
Srp72 T A 5: 77,124,329 (GRCm39) L65* probably null Het
Steap1 T A 5: 5,790,664 (GRCm39) I95F Het
Taf3 A G 2: 9,955,923 (GRCm39) probably null Het
Taok2 T C 7: 126,469,400 (GRCm39) N1143D Het
Tas2r114 C T 6: 131,666,894 (GRCm39) G45S possibly damaging Het
Tcerg1l T C 7: 137,811,551 (GRCm39) K548E probably damaging Het
Tcp1 T A 17: 13,141,505 (GRCm39) L328Q probably benign Het
Tns2 A G 15: 102,021,623 (GRCm39) H1096R probably damaging Het
Trps1 A T 15: 50,709,652 (GRCm39) Y233N probably damaging Het
Tubgcp6 A G 15: 88,987,064 (GRCm39) V1303A probably benign Het
Ugt1a2 T C 1: 88,128,684 (GRCm39) F109S possibly damaging Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Zfp748 A G 13: 67,693,511 (GRCm39) V54A probably benign Het
Other mutations in Krit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Krit1 APN 5 3,862,844 (GRCm39) missense probably damaging 0.98
IGL02186:Krit1 APN 5 3,859,733 (GRCm39) splice site probably benign
IGL02526:Krit1 APN 5 3,872,103 (GRCm39) missense probably damaging 1.00
IGL03280:Krit1 APN 5 3,861,248 (GRCm39) splice site probably benign
IGL03385:Krit1 APN 5 3,857,452 (GRCm39) missense possibly damaging 0.51
Waspish UTSW 5 3,881,551 (GRCm39) missense probably damaging 1.00
R0127:Krit1 UTSW 5 3,872,178 (GRCm39) missense probably damaging 0.99
R0594:Krit1 UTSW 5 3,873,694 (GRCm39) missense possibly damaging 0.71
R1157:Krit1 UTSW 5 3,882,176 (GRCm39) missense probably damaging 1.00
R1777:Krit1 UTSW 5 3,886,799 (GRCm39) missense probably damaging 0.96
R2115:Krit1 UTSW 5 3,872,108 (GRCm39) nonsense probably null
R4021:Krit1 UTSW 5 3,882,132 (GRCm39) missense probably benign 0.21
R4041:Krit1 UTSW 5 3,859,642 (GRCm39) missense probably damaging 1.00
R4786:Krit1 UTSW 5 3,862,467 (GRCm39) missense possibly damaging 0.86
R4989:Krit1 UTSW 5 3,872,238 (GRCm39) missense probably damaging 1.00
R5217:Krit1 UTSW 5 3,856,451 (GRCm39) nonsense probably null
R5304:Krit1 UTSW 5 3,869,326 (GRCm39) missense probably damaging 0.99
R5371:Krit1 UTSW 5 3,881,551 (GRCm39) missense probably damaging 1.00
R5682:Krit1 UTSW 5 3,880,737 (GRCm39) missense probably damaging 0.99
R6248:Krit1 UTSW 5 3,863,032 (GRCm39) splice site probably null
R6338:Krit1 UTSW 5 3,886,857 (GRCm39) missense probably benign 0.01
R7081:Krit1 UTSW 5 3,873,651 (GRCm39) missense possibly damaging 0.71
R7454:Krit1 UTSW 5 3,862,474 (GRCm39) missense probably damaging 0.99
R7497:Krit1 UTSW 5 3,862,349 (GRCm39) missense possibly damaging 0.93
R7684:Krit1 UTSW 5 3,880,723 (GRCm39) missense possibly damaging 0.75
R7780:Krit1 UTSW 5 3,862,772 (GRCm39) missense probably damaging 1.00
R7862:Krit1 UTSW 5 3,862,788 (GRCm39) missense probably damaging 0.99
R8041:Krit1 UTSW 5 3,857,309 (GRCm39) missense probably benign
R8882:Krit1 UTSW 5 3,886,864 (GRCm39) missense possibly damaging 0.72
R9034:Krit1 UTSW 5 3,862,996 (GRCm39) intron probably benign
R9098:Krit1 UTSW 5 3,863,135 (GRCm39) missense probably benign 0.00
R9328:Krit1 UTSW 5 3,862,577 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGAAATTATCTTGTTCCTCTATGGT -3'
(R):5'- TGAAGCATTTCAGTTTGAACACTAAT -3'

Sequencing Primer
(F):5'- TGGGCTGCAAATCCCTTAAG -3'
(R):5'- CATCCAAAAAGGAGCAATG -3'
Posted On 2022-05-16