Incidental Mutation 'R9402:Exoc4'
ID 711282
Institutional Source Beutler Lab
Gene Symbol Exoc4
Ensembl Gene ENSMUSG00000029763
Gene Name exocyst complex component 4
Synonyms Sec8l1, Sec8
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9402 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 33249085-33973979 bp(+) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) T to A at 33476143 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Lysine at position 523 (*523K)
Ref Sequence ENSEMBL: ENSMUSP00000087859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052266] [ENSMUST00000090381] [ENSMUST00000115080]
AlphaFold O35382
Predicted Effect probably benign
Transcript: ENSMUST00000052266
SMART Domains Protein: ENSMUSP00000051965
Gene: ENSMUSG00000029763

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 28 144 2.4e-21 PFAM
low complexity region 338 346 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090381
AA Change: *523K
SMART Domains Protein: ENSMUSP00000087859
Gene: ENSMUSG00000029763
AA Change: *523K

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 24 144 1.1e-36 PFAM
low complexity region 338 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115080
SMART Domains Protein: ENSMUSP00000110732
Gene: ENSMUSG00000029763

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 24 144 7.4e-37 PFAM
low complexity region 338 346 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic abnormatlities. Gastrulation is not completed and mesoderm formation is abnormal. Death occurs before E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T G 1: 136,227,610 S86R probably benign Het
Abca9 T A 11: 110,158,328 Q218L probably benign Het
Atg2b A G 12: 105,648,423 F1083S probably damaging Het
Bche T C 3: 73,701,323 N257D probably benign Het
Cfap221 T A 1: 119,932,821 M692L probably benign Het
Cfap46 G T 7: 139,635,949 P1530Q unknown Het
Crim1 CCGC CC 17: 78,350,865 probably null Het
Cyp4f39 T C 17: 32,491,209 probably null Het
Daam1 A G 12: 71,959,830 T674A probably benign Het
Elp2 A T 18: 24,626,163 I526L probably benign Het
Fbxl7 G A 15: 26,552,503 S226L probably damaging Het
Fry G A 5: 150,433,696 E1903K possibly damaging Het
Fry G A 5: 150,436,853 R1988K probably damaging Het
Gas1 A T 13: 60,176,202 M206K probably damaging Het
Gbp10 T A 5: 105,233,997 T96S possibly damaging Het
Gm14569 G A X: 36,430,896 P1387S probably damaging Het
Gpaa1 A G 15: 76,332,218 T105A probably benign Het
Hoxc13 C A 15: 102,921,616 C143* probably null Het
Htt T C 5: 34,848,980 I1411T probably damaging Het
Jmy C T 13: 93,499,170 C46Y probably damaging Het
Klhl40 A G 9: 121,780,416 Y453C possibly damaging Het
Krit1 T A 5: 3,822,210 Y460N possibly damaging Het
Lamb3 C A 1: 193,331,396 T526K Het
Lrrc29 T A 8: 105,323,356 Y12F probably benign Het
Luzp1 T A 4: 136,543,182 H905Q probably damaging Het
Lyst T A 13: 13,637,878 H958Q probably benign Het
Magi1 T C 6: 94,283,297 N9S probably benign Het
Mmadhc A T 2: 50,281,107 V231E probably benign Het
Muc5b T A 7: 141,845,414 M364K unknown Het
Nae1 A G 8: 104,528,185 probably null Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Nlgn2 A G 11: 69,828,107 F252S Het
Nlrp9a A T 7: 26,570,605 N874I possibly damaging Het
Nodal T C 10: 61,423,600 I272T probably damaging Het
Olfr1234 C A 2: 89,362,779 G217* probably null Het
Olfr1259 A T 2: 89,943,940 Y58* probably null Het
Olfr599 T C 7: 103,338,989 S312P probably benign Het
Olfr645 G A 7: 104,084,403 R226* probably null Het
Orm1 C A 4: 63,345,132 Q61K possibly damaging Het
Pcdh17 T C 14: 84,447,206 V371A probably damaging Het
Pcdhb19 C T 18: 37,499,479 Q776* probably null Het
Phf14 A G 6: 11,933,780 R214G possibly damaging Het
Phf3 G A 1: 30,811,847 T1142M probably damaging Het
Pigz A G 16: 31,945,369 E415G probably damaging Het
Pramel5 T C 4: 144,271,456 T406A probably benign Het
Prtg A G 9: 72,911,971 E1082G probably benign Het
Rtp3 A G 9: 110,985,963 C445R unknown Het
Scn3b A T 9: 40,282,556 E193V probably damaging Het
Scn7a A T 2: 66,680,112 N1315K probably damaging Het
Snx14 C T 9: 88,407,437 G254D probably damaging Het
Srbd1 T C 17: 86,099,277 D560G probably benign Het
Srp72 T A 5: 76,976,482 L65* probably null Het
Steap1 T A 5: 5,740,664 I95F Het
Taf3 A G 2: 9,951,112 probably null Het
Taok2 T C 7: 126,870,228 N1143D Het
Tas2r114 C T 6: 131,689,931 G45S possibly damaging Het
Tcerg1l T C 7: 138,209,822 K548E probably damaging Het
Tcp1 T A 17: 12,922,618 L328Q probably benign Het
Tns2 A G 15: 102,113,188 H1096R probably damaging Het
Trps1 A T 15: 50,846,256 Y233N probably damaging Het
Tubgcp6 A G 15: 89,102,861 V1303A probably benign Het
Ugt1a2 T C 1: 88,200,962 F109S possibly damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Zfp748 A G 13: 67,545,392 V54A probably benign Het
Other mutations in Exoc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Exoc4 APN 6 33918399 critical splice acceptor site probably null
IGL00433:Exoc4 APN 6 33296788 missense probably damaging 1.00
IGL00833:Exoc4 APN 6 33971924 missense probably damaging 1.00
IGL01339:Exoc4 APN 6 33305400 splice site probably benign
IGL01559:Exoc4 APN 6 33266076 missense probably damaging 0.96
IGL01812:Exoc4 APN 6 33757959 splice site probably benign
IGL01926:Exoc4 APN 6 33862142 missense probably damaging 1.00
IGL02270:Exoc4 APN 6 33580026 missense possibly damaging 0.61
IGL02316:Exoc4 APN 6 33910584 missense probably damaging 0.98
IGL02332:Exoc4 APN 6 33249240 critical splice donor site probably null
IGL02668:Exoc4 APN 6 33921532 missense probably benign 0.00
slacker UTSW 6 33758098 missense probably damaging 1.00
R0049:Exoc4 UTSW 6 33296922 splice site probably null
R0134:Exoc4 UTSW 6 33971946 missense possibly damaging 0.56
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0538:Exoc4 UTSW 6 33972063 missense probably benign 0.09
R1033:Exoc4 UTSW 6 33265987 missense probably damaging 1.00
R1067:Exoc4 UTSW 6 33918424 missense possibly damaging 0.87
R1109:Exoc4 UTSW 6 33442016 missense probably damaging 1.00
R1768:Exoc4 UTSW 6 33758050 missense probably damaging 1.00
R2013:Exoc4 UTSW 6 33266091 missense probably damaging 0.96
R2078:Exoc4 UTSW 6 33910587 missense probably benign 0.06
R2114:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2115:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2117:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2133:Exoc4 UTSW 6 33758158 missense probably benign 0.00
R2133:Exoc4 UTSW 6 33910538 missense probably benign
R2308:Exoc4 UTSW 6 33918568 missense probably damaging 1.00
R3412:Exoc4 UTSW 6 33265975 missense probably damaging 1.00
R3794:Exoc4 UTSW 6 33475997 missense probably benign
R3885:Exoc4 UTSW 6 33266131 critical splice donor site probably null
R4378:Exoc4 UTSW 6 33815687 missense probably damaging 1.00
R4534:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4535:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4536:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4611:Exoc4 UTSW 6 33438405 missense possibly damaging 0.77
R4617:Exoc4 UTSW 6 33862204 missense probably benign 0.00
R4771:Exoc4 UTSW 6 33441949 critical splice acceptor site probably null
R4851:Exoc4 UTSW 6 33918408 missense probably damaging 0.96
R4921:Exoc4 UTSW 6 33910517 missense probably benign
R5358:Exoc4 UTSW 6 33265999 missense probably damaging 1.00
R5767:Exoc4 UTSW 6 33918432 missense probably benign
R6014:Exoc4 UTSW 6 33475997 missense probably benign
R6132:Exoc4 UTSW 6 33758098 missense probably damaging 1.00
R6164:Exoc4 UTSW 6 33332283 missense probably damaging 0.99
R6583:Exoc4 UTSW 6 33815753 missense probably damaging 1.00
R6915:Exoc4 UTSW 6 33921453 missense possibly damaging 0.81
R6973:Exoc4 UTSW 6 33580030 missense probably damaging 1.00
R7112:Exoc4 UTSW 6 33921488 missense probably damaging 1.00
R7129:Exoc4 UTSW 6 33971999 missense probably damaging 1.00
R7133:Exoc4 UTSW 6 33438473 missense probably benign 0.07
R7547:Exoc4 UTSW 6 33839121 missense possibly damaging 0.95
R7885:Exoc4 UTSW 6 33758066 missense probably benign 0.00
R8024:Exoc4 UTSW 6 33347931 missense probably damaging 1.00
R8053:Exoc4 UTSW 6 33332256 missense probably benign 0.45
R8118:Exoc4 UTSW 6 33971918 missense probably damaging 1.00
R8154:Exoc4 UTSW 6 33910538 missense probably benign
R8485:Exoc4 UTSW 6 33921501 missense probably damaging 1.00
R9226:Exoc4 UTSW 6 33918424 missense possibly damaging 0.87
R9612:Exoc4 UTSW 6 33249226 missense probably benign 0.19
R9711:Exoc4 UTSW 6 33476056 missense unknown
X0066:Exoc4 UTSW 6 33815690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGAGCTGAGCCTCCAT -3'
(R):5'- ACCCTTCAGCCTACAGTGAG -3'

Sequencing Primer
(F):5'- ATCTGATTCAGACCTGTGCAG -3'
(R):5'- TTCAGCCTACAGTGAGACCTG -3'
Posted On 2022-05-16