Incidental Mutation 'R9402:Vmn1r43'
ID 711283
Institutional Source Beutler Lab
Gene Symbol Vmn1r43
Ensembl Gene ENSMUSG00000068231
Gene Name vomeronasal 1 receptor 43
Synonyms V1ra5
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R9402 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 89846443-89847511 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 89846877 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 203 (T203M)
Ref Sequence ENSEMBL: ENSMUSP00000086839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089418] [ENSMUST00000226741] [ENSMUST00000226983] [ENSMUST00000227279] [ENSMUST00000228709]
AlphaFold Q8VIC9
Predicted Effect probably damaging
Transcript: ENSMUST00000089418
AA Change: T203M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086839
Gene: ENSMUSG00000068231
AA Change: T203M

DomainStartEndE-ValueType
Pfam:V1R 54 318 2.9e-126 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226741
AA Change: T203M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000226983
AA Change: T203M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000227279
Predicted Effect probably damaging
Transcript: ENSMUST00000228709
AA Change: T203M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,049,154 (GRCm39) Q218L probably benign Het
Atg2b A G 12: 105,614,682 (GRCm39) F1083S probably damaging Het
Bche T C 3: 73,608,656 (GRCm39) N257D probably benign Het
Cfap221 T A 1: 119,860,551 (GRCm39) M692L probably benign Het
Cfap46 G T 7: 139,215,865 (GRCm39) P1530Q unknown Het
Crim1 CCGC CC 17: 78,658,294 (GRCm39) probably null Het
Cyp4f39 T C 17: 32,710,183 (GRCm39) probably null Het
Daam1 A G 12: 72,006,604 (GRCm39) T674A probably benign Het
Elp2 A T 18: 24,759,220 (GRCm39) I526L probably benign Het
Exoc4 T A 6: 33,453,078 (GRCm39) *523K probably null Het
Fbxl7 G A 15: 26,552,589 (GRCm39) S226L probably damaging Het
Fbxl9 T A 8: 106,049,988 (GRCm39) Y12F probably benign Het
Fry G A 5: 150,357,161 (GRCm39) E1903K possibly damaging Het
Fry G A 5: 150,360,318 (GRCm39) R1988K probably damaging Het
Gas1 A T 13: 60,324,016 (GRCm39) M206K probably damaging Het
Gbp10 T A 5: 105,381,863 (GRCm39) T96S possibly damaging Het
Gm14569 G A X: 35,694,549 (GRCm39) P1387S probably damaging Het
Gpaa1 A G 15: 76,216,418 (GRCm39) T105A probably benign Het
Hoxc13 C A 15: 102,830,051 (GRCm39) C143* probably null Het
Htt T C 5: 35,006,324 (GRCm39) I1411T probably damaging Het
Inava T G 1: 136,155,348 (GRCm39) S86R probably benign Het
Jmy C T 13: 93,635,678 (GRCm39) C46Y probably damaging Het
Klhl40 A G 9: 121,609,482 (GRCm39) Y453C possibly damaging Het
Krit1 T A 5: 3,872,210 (GRCm39) Y460N possibly damaging Het
Lamb3 C A 1: 193,013,704 (GRCm39) T526K Het
Luzp1 T A 4: 136,270,493 (GRCm39) H905Q probably damaging Het
Lyst T A 13: 13,812,463 (GRCm39) H958Q probably benign Het
Magi1 T C 6: 94,260,278 (GRCm39) N9S probably benign Het
Mmadhc A T 2: 50,171,119 (GRCm39) V231E probably benign Het
Muc5b T A 7: 141,399,151 (GRCm39) M364K unknown Het
Nae1 A G 8: 105,254,817 (GRCm39) probably null Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Nlgn2 A G 11: 69,718,933 (GRCm39) F252S Het
Nlrp9a A T 7: 26,270,030 (GRCm39) N874I possibly damaging Het
Nodal T C 10: 61,259,379 (GRCm39) I272T probably damaging Het
Or4a15 C A 2: 89,193,123 (GRCm39) G217* probably null Het
Or4c12 A T 2: 89,774,284 (GRCm39) Y58* probably null Het
Or51a24 G A 7: 103,733,610 (GRCm39) R226* probably null Het
Or52ab4 T C 7: 102,988,196 (GRCm39) S312P probably benign Het
Orm1 C A 4: 63,263,369 (GRCm39) Q61K possibly damaging Het
Pcdh17 T C 14: 84,684,646 (GRCm39) V371A probably damaging Het
Pcdhb19 C T 18: 37,632,532 (GRCm39) Q776* probably null Het
Phf14 A G 6: 11,933,779 (GRCm39) R214G possibly damaging Het
Phf3 G A 1: 30,850,928 (GRCm39) T1142M probably damaging Het
Pigz A G 16: 31,764,187 (GRCm39) E415G probably damaging Het
Pramel5 T C 4: 143,998,026 (GRCm39) T406A probably benign Het
Prtg A G 9: 72,819,253 (GRCm39) E1082G probably benign Het
Rtp3 A G 9: 110,815,031 (GRCm39) C445R unknown Het
Scn3b A T 9: 40,193,852 (GRCm39) E193V probably damaging Het
Scn7a A T 2: 66,510,456 (GRCm39) N1315K probably damaging Het
Snx14 C T 9: 88,289,490 (GRCm39) G254D probably damaging Het
Srbd1 T C 17: 86,406,705 (GRCm39) D560G probably benign Het
Srp72 T A 5: 77,124,329 (GRCm39) L65* probably null Het
Steap1 T A 5: 5,790,664 (GRCm39) I95F Het
Taf3 A G 2: 9,955,923 (GRCm39) probably null Het
Taok2 T C 7: 126,469,400 (GRCm39) N1143D Het
Tas2r114 C T 6: 131,666,894 (GRCm39) G45S possibly damaging Het
Tcerg1l T C 7: 137,811,551 (GRCm39) K548E probably damaging Het
Tcp1 T A 17: 13,141,505 (GRCm39) L328Q probably benign Het
Tns2 A G 15: 102,021,623 (GRCm39) H1096R probably damaging Het
Trps1 A T 15: 50,709,652 (GRCm39) Y233N probably damaging Het
Tubgcp6 A G 15: 88,987,064 (GRCm39) V1303A probably benign Het
Ugt1a2 T C 1: 88,128,684 (GRCm39) F109S possibly damaging Het
Zfp748 A G 13: 67,693,511 (GRCm39) V54A probably benign Het
Other mutations in Vmn1r43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01748:Vmn1r43 APN 6 89,847,294 (GRCm39) missense probably damaging 1.00
IGL02476:Vmn1r43 APN 6 89,847,043 (GRCm39) missense possibly damaging 0.95
IGL02958:Vmn1r43 APN 6 89,847,031 (GRCm39) missense probably benign 0.09
R0413:Vmn1r43 UTSW 6 89,846,830 (GRCm39) missense probably damaging 1.00
R1662:Vmn1r43 UTSW 6 89,846,572 (GRCm39) missense possibly damaging 0.76
R1668:Vmn1r43 UTSW 6 89,846,683 (GRCm39) missense probably benign 0.01
R4419:Vmn1r43 UTSW 6 89,846,629 (GRCm39) missense probably benign 0.01
R4719:Vmn1r43 UTSW 6 89,846,837 (GRCm39) missense probably benign 0.02
R4798:Vmn1r43 UTSW 6 89,846,892 (GRCm39) missense probably benign 0.01
R5520:Vmn1r43 UTSW 6 89,846,728 (GRCm39) missense probably damaging 0.98
R5643:Vmn1r43 UTSW 6 89,847,354 (GRCm39) missense probably damaging 1.00
R5644:Vmn1r43 UTSW 6 89,847,354 (GRCm39) missense probably damaging 1.00
R5717:Vmn1r43 UTSW 6 89,846,905 (GRCm39) missense probably damaging 1.00
R6647:Vmn1r43 UTSW 6 89,846,841 (GRCm39) missense probably damaging 1.00
R6914:Vmn1r43 UTSW 6 89,847,319 (GRCm39) missense probably benign 0.02
R6942:Vmn1r43 UTSW 6 89,847,319 (GRCm39) missense probably benign 0.02
R7092:Vmn1r43 UTSW 6 89,846,885 (GRCm39) missense probably benign 0.02
R7402:Vmn1r43 UTSW 6 89,846,803 (GRCm39) missense probably benign 0.02
R7457:Vmn1r43 UTSW 6 89,847,172 (GRCm39) missense probably damaging 0.98
R7572:Vmn1r43 UTSW 6 89,846,547 (GRCm39) missense possibly damaging 0.93
R7807:Vmn1r43 UTSW 6 89,847,219 (GRCm39) missense probably benign 0.07
R8406:Vmn1r43 UTSW 6 89,847,414 (GRCm39) missense possibly damaging 0.55
R8696:Vmn1r43 UTSW 6 89,847,321 (GRCm39) missense probably damaging 0.99
R8859:Vmn1r43 UTSW 6 89,846,937 (GRCm39) missense probably damaging 1.00
R8894:Vmn1r43 UTSW 6 89,846,746 (GRCm39) missense probably benign 0.02
R9072:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9073:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9075:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9076:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9237:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9239:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9240:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9293:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9383:Vmn1r43 UTSW 6 89,846,552 (GRCm39) missense possibly damaging 0.94
R9398:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9399:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9401:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9594:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9595:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9596:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9624:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9628:Vmn1r43 UTSW 6 89,846,877 (GRCm39) missense probably damaging 1.00
R9656:Vmn1r43 UTSW 6 89,847,440 (GRCm39) missense possibly damaging 0.47
X0020:Vmn1r43 UTSW 6 89,847,316 (GRCm39) missense probably benign 0.00
Z1177:Vmn1r43 UTSW 6 89,847,467 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCATGAGCATCAGGATGG -3'
(R):5'- CCATCATTCTTAGTCCCAGAAGC -3'

Sequencing Primer
(F):5'- CATCAGGATGGTCTGGGTAGCAC -3'
(R):5'- GTCCCAGAAGCTCCTGTTTATCAAAG -3'
Posted On 2022-05-16