Incidental Mutation 'R9402:Or52ab4'
ID 711287
Institutional Source Beutler Lab
Gene Symbol Or52ab4
Ensembl Gene ENSMUSG00000073950
Gene Name olfactory receptor family 52 subfamily AB member 4
Synonyms Olfr599, MOR23-1, GA_x6K02T2PBJ9-6047402-6048349
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9402 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102987219-102988268 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102988196 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 312 (S312P)
Ref Sequence ENSEMBL: ENSMUSP00000149281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098201] [ENSMUST00000214329] [ENSMUST00000215042]
AlphaFold Q8VG01
Predicted Effect probably benign
Transcript: ENSMUST00000098201
AA Change: S312P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095803
Gene: ENSMUSG00000073950
AA Change: S312P

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.8e-94 PFAM
Pfam:7TM_GPCR_Srsx 37 308 1.2e-6 PFAM
Pfam:7tm_1 43 293 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214329
AA Change: S312P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215042
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,049,154 (GRCm39) Q218L probably benign Het
Atg2b A G 12: 105,614,682 (GRCm39) F1083S probably damaging Het
Bche T C 3: 73,608,656 (GRCm39) N257D probably benign Het
Cfap221 T A 1: 119,860,551 (GRCm39) M692L probably benign Het
Cfap46 G T 7: 139,215,865 (GRCm39) P1530Q unknown Het
Crim1 CCGC CC 17: 78,658,294 (GRCm39) probably null Het
Cyp4f39 T C 17: 32,710,183 (GRCm39) probably null Het
Daam1 A G 12: 72,006,604 (GRCm39) T674A probably benign Het
Elp2 A T 18: 24,759,220 (GRCm39) I526L probably benign Het
Exoc4 T A 6: 33,453,078 (GRCm39) *523K probably null Het
Fbxl7 G A 15: 26,552,589 (GRCm39) S226L probably damaging Het
Fbxl9 T A 8: 106,049,988 (GRCm39) Y12F probably benign Het
Fry G A 5: 150,357,161 (GRCm39) E1903K possibly damaging Het
Fry G A 5: 150,360,318 (GRCm39) R1988K probably damaging Het
Gas1 A T 13: 60,324,016 (GRCm39) M206K probably damaging Het
Gbp10 T A 5: 105,381,863 (GRCm39) T96S possibly damaging Het
Gm14569 G A X: 35,694,549 (GRCm39) P1387S probably damaging Het
Gpaa1 A G 15: 76,216,418 (GRCm39) T105A probably benign Het
Hoxc13 C A 15: 102,830,051 (GRCm39) C143* probably null Het
Htt T C 5: 35,006,324 (GRCm39) I1411T probably damaging Het
Inava T G 1: 136,155,348 (GRCm39) S86R probably benign Het
Jmy C T 13: 93,635,678 (GRCm39) C46Y probably damaging Het
Klhl40 A G 9: 121,609,482 (GRCm39) Y453C possibly damaging Het
Krit1 T A 5: 3,872,210 (GRCm39) Y460N possibly damaging Het
Lamb3 C A 1: 193,013,704 (GRCm39) T526K Het
Luzp1 T A 4: 136,270,493 (GRCm39) H905Q probably damaging Het
Lyst T A 13: 13,812,463 (GRCm39) H958Q probably benign Het
Magi1 T C 6: 94,260,278 (GRCm39) N9S probably benign Het
Mmadhc A T 2: 50,171,119 (GRCm39) V231E probably benign Het
Muc5b T A 7: 141,399,151 (GRCm39) M364K unknown Het
Nae1 A G 8: 105,254,817 (GRCm39) probably null Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Nlgn2 A G 11: 69,718,933 (GRCm39) F252S Het
Nlrp9a A T 7: 26,270,030 (GRCm39) N874I possibly damaging Het
Nodal T C 10: 61,259,379 (GRCm39) I272T probably damaging Het
Or4a15 C A 2: 89,193,123 (GRCm39) G217* probably null Het
Or4c12 A T 2: 89,774,284 (GRCm39) Y58* probably null Het
Or51a24 G A 7: 103,733,610 (GRCm39) R226* probably null Het
Orm1 C A 4: 63,263,369 (GRCm39) Q61K possibly damaging Het
Pcdh17 T C 14: 84,684,646 (GRCm39) V371A probably damaging Het
Pcdhb19 C T 18: 37,632,532 (GRCm39) Q776* probably null Het
Phf14 A G 6: 11,933,779 (GRCm39) R214G possibly damaging Het
Phf3 G A 1: 30,850,928 (GRCm39) T1142M probably damaging Het
Pigz A G 16: 31,764,187 (GRCm39) E415G probably damaging Het
Pramel5 T C 4: 143,998,026 (GRCm39) T406A probably benign Het
Prtg A G 9: 72,819,253 (GRCm39) E1082G probably benign Het
Rtp3 A G 9: 110,815,031 (GRCm39) C445R unknown Het
Scn3b A T 9: 40,193,852 (GRCm39) E193V probably damaging Het
Scn7a A T 2: 66,510,456 (GRCm39) N1315K probably damaging Het
Snx14 C T 9: 88,289,490 (GRCm39) G254D probably damaging Het
Srbd1 T C 17: 86,406,705 (GRCm39) D560G probably benign Het
Srp72 T A 5: 77,124,329 (GRCm39) L65* probably null Het
Steap1 T A 5: 5,790,664 (GRCm39) I95F Het
Taf3 A G 2: 9,955,923 (GRCm39) probably null Het
Taok2 T C 7: 126,469,400 (GRCm39) N1143D Het
Tas2r114 C T 6: 131,666,894 (GRCm39) G45S possibly damaging Het
Tcerg1l T C 7: 137,811,551 (GRCm39) K548E probably damaging Het
Tcp1 T A 17: 13,141,505 (GRCm39) L328Q probably benign Het
Tns2 A G 15: 102,021,623 (GRCm39) H1096R probably damaging Het
Trps1 A T 15: 50,709,652 (GRCm39) Y233N probably damaging Het
Tubgcp6 A G 15: 88,987,064 (GRCm39) V1303A probably benign Het
Ugt1a2 T C 1: 88,128,684 (GRCm39) F109S possibly damaging Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Zfp748 A G 13: 67,693,511 (GRCm39) V54A probably benign Het
Other mutations in Or52ab4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Or52ab4 APN 7 102,987,974 (GRCm39) nonsense probably null
IGL01744:Or52ab4 APN 7 102,987,435 (GRCm39) missense probably damaging 0.98
IGL02011:Or52ab4 APN 7 102,988,056 (GRCm39) missense probably damaging 0.98
IGL02328:Or52ab4 APN 7 102,987,497 (GRCm39) missense probably damaging 1.00
IGL02630:Or52ab4 APN 7 102,987,636 (GRCm39) missense probably damaging 1.00
IGL03119:Or52ab4 APN 7 102,987,929 (GRCm39) missense probably damaging 1.00
PIT4468001:Or52ab4 UTSW 7 102,987,807 (GRCm39) missense probably damaging 1.00
R0599:Or52ab4 UTSW 7 102,987,393 (GRCm39) missense probably damaging 1.00
R4084:Or52ab4 UTSW 7 102,987,527 (GRCm39) missense probably damaging 0.99
R5068:Or52ab4 UTSW 7 102,987,229 (GRCm39) start gained probably null
R5069:Or52ab4 UTSW 7 102,987,229 (GRCm39) start gained probably null
R5280:Or52ab4 UTSW 7 102,987,708 (GRCm39) missense probably benign
R5816:Or52ab4 UTSW 7 102,988,202 (GRCm39) missense probably benign 0.00
R6560:Or52ab4 UTSW 7 102,987,945 (GRCm39) missense probably benign 0.02
R7001:Or52ab4 UTSW 7 102,987,428 (GRCm39) missense possibly damaging 0.51
R7890:Or52ab4 UTSW 7 102,987,537 (GRCm39) missense probably benign
R8295:Or52ab4 UTSW 7 102,987,474 (GRCm39) missense probably benign 0.08
R8430:Or52ab4 UTSW 7 102,988,164 (GRCm39) missense probably benign 0.01
R8946:Or52ab4 UTSW 7 102,987,573 (GRCm39) missense probably damaging 1.00
R9045:Or52ab4 UTSW 7 102,987,903 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCATATGGGCTCTTTGTGGC -3'
(R):5'- CTGTTTATCCCATGCTGACTGG -3'

Sequencing Primer
(F):5'- GCATTCAACACTTGTACGGC -3'
(R):5'- ATCCCATGCTGACTGGTTTTG -3'
Posted On 2022-05-16