Mutagenetix > Incidental Mutation

Incidental Mutation 'R9402:Prtg'

711296

Institutional Source

Beutler Lab

Gene Symbol

Prtg

Ensembl Gene

ENSMUSG00000036030

Gene Name

protogenin

Synonyms

Igdcc5, A230098A12Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.658) question?

Stock #

R9402 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72806874-72917291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72911971 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1082 (E1082G)

Ref Sequence

ENSEMBL: ENSMUSP00000055815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055535]

AlphaFold

Q2EY15

Predicted Effect

probably benign
Transcript: ENSMUST00000055535
AA Change: E1082G

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000055815
Gene: ENSMUSG00000036030
AA Change: E1082G

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IGc2	45	114	1.7e-8	SMART
IGc2	141	206	8.5e-12	SMART
IGc2	241	305	6.9e-12	SMART
IGc2	333	396	9.4e-10	SMART
FN3	413	496	8.9e-11	SMART
FN3	511	594	1.3e-10	SMART
FN3	613	693	1.5e-5	SMART
FN3	715	798	3e-10	SMART
FN3	814	898	4.4e-12	SMART
transmembrane domain	943	965	N/A	INTRINSIC
low complexity region	966	976	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded transmembrane protein has been associated with the development of various tissues, especially neurogenesis. It has been suggested that this gene may be associated with attention deficit hyperactivity disorder (ADHD). [provided by RefSeq, Nov 2014]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	G	1: 136,227,610	S86R	probably benign	Het
Abca9	T	A	11: 110,158,328	Q218L	probably benign	Het
Atg2b	A	G	12: 105,648,423	F1083S	probably damaging	Het
Bche	T	C	3: 73,701,323	N257D	probably benign	Het
Cfap221	T	A	1: 119,932,821	M692L	probably benign	Het
Cfap46	G	T	7: 139,635,949	P1530Q	unknown	Het
Crim1	CCGC	CC	17: 78,350,865		probably null	Het
Cyp4f39	T	C	17: 32,491,209		probably null	Het
Daam1	A	G	12: 71,959,830	T674A	probably benign	Het
Elp2	A	T	18: 24,626,163	I526L	probably benign	Het
Exoc4	T	A	6: 33,476,143	*523K	probably null	Het
Fbxl7	G	A	15: 26,552,503	S226L	probably damaging	Het
Fry	G	A	5: 150,433,696	E1903K	possibly damaging	Het
Fry	G	A	5: 150,436,853	R1988K	probably damaging	Het
Gas1	A	T	13: 60,176,202	M206K	probably damaging	Het
Gbp10	T	A	5: 105,233,997	T96S	possibly damaging	Het
Gm14569	G	A	X: 36,430,896	P1387S	probably damaging	Het
Gpaa1	A	G	15: 76,332,218	T105A	probably benign	Het
Hoxc13	C	A	15: 102,921,616	C143*	probably null	Het
Htt	T	C	5: 34,848,980	I1411T	probably damaging	Het
Jmy	C	T	13: 93,499,170	C46Y	probably damaging	Het
Klhl40	A	G	9: 121,780,416	Y453C	possibly damaging	Het
Krit1	T	A	5: 3,822,210	Y460N	possibly damaging	Het
Lamb3	C	A	1: 193,331,396	T526K		Het
Lrrc29	T	A	8: 105,323,356	Y12F	probably benign	Het
Luzp1	T	A	4: 136,543,182	H905Q	probably damaging	Het
Lyst	T	A	13: 13,637,878	H958Q	probably benign	Het
Magi1	T	C	6: 94,283,297	N9S	probably benign	Het
Mmadhc	A	T	2: 50,281,107	V231E	probably benign	Het
Muc5b	T	A	7: 141,845,414	M364K	unknown	Het
Nae1	A	G	8: 104,528,185		probably null	Het
Ndst4	C	T	3: 125,724,736	S354L	probably benign	Het
Nlgn2	A	G	11: 69,828,107	F252S		Het
Nlrp9a	A	T	7: 26,570,605	N874I	possibly damaging	Het
Nodal	T	C	10: 61,423,600	I272T	probably damaging	Het
Olfr1234	C	A	2: 89,362,779	G217*	probably null	Het
Olfr1259	A	T	2: 89,943,940	Y58*	probably null	Het
Olfr599	T	C	7: 103,338,989	S312P	probably benign	Het
Olfr645	G	A	7: 104,084,403	R226*	probably null	Het
Orm1	C	A	4: 63,345,132	Q61K	possibly damaging	Het
Pcdh17	T	C	14: 84,447,206	V371A	probably damaging	Het
Pcdhb19	C	T	18: 37,499,479	Q776*	probably null	Het
Phf14	A	G	6: 11,933,780	R214G	possibly damaging	Het
Phf3	G	A	1: 30,811,847	T1142M	probably damaging	Het
Pigz	A	G	16: 31,945,369	E415G	probably damaging	Het
Pramel5	T	C	4: 144,271,456	T406A	probably benign	Het
Rtp3	A	G	9: 110,985,963	C445R	unknown	Het
Scn3b	A	T	9: 40,282,556	E193V	probably damaging	Het
Scn7a	A	T	2: 66,680,112	N1315K	probably damaging	Het
Snx14	C	T	9: 88,407,437	G254D	probably damaging	Het
Srbd1	T	C	17: 86,099,277	D560G	probably benign	Het
Srp72	T	A	5: 76,976,482	L65*	probably null	Het
Steap1	T	A	5: 5,740,664	I95F		Het
Taf3	A	G	2: 9,951,112		probably null	Het
Taok2	T	C	7: 126,870,228	N1143D		Het
Tas2r114	C	T	6: 131,689,931	G45S	possibly damaging	Het
Tcerg1l	T	C	7: 138,209,822	K548E	probably damaging	Het
Tcp1	T	A	17: 12,922,618	L328Q	probably benign	Het
Tns2	A	G	15: 102,113,188	H1096R	probably damaging	Het
Trps1	A	T	15: 50,846,256	Y233N	probably damaging	Het
Tubgcp6	A	G	15: 89,102,861	V1303A	probably benign	Het
Ugt1a2	T	C	1: 88,200,962	F109S	possibly damaging	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Zfp748	A	G	13: 67,545,392	V54A	probably benign	Het

Other mutations in Prtg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00597:Prtg	APN	9	72809644	missense	probably damaging	1.00
IGL00942:Prtg	APN	9	72892340	missense	possibly damaging	0.82
IGL01821:Prtg	APN	9	72911937	missense	probably damaging	0.98
IGL01901:Prtg	APN	9	72855066	missense	probably damaging	1.00
IGL02143:Prtg	APN	9	72892324	missense	probably damaging	1.00
IGL02232:Prtg	APN	9	72851489	missense	probably damaging	1.00
IGL02451:Prtg	APN	9	72856999	missense	possibly damaging	0.95
IGL02510:Prtg	APN	9	72890869	missense	probably damaging	0.99
IGL02739:Prtg	APN	9	72851585	missense	possibly damaging	0.92
IGL03136:Prtg	APN	9	72856985	missense	possibly damaging	0.91
FR4548:Prtg	UTSW	9	72857081	critical splice donor site	probably benign
FR4589:Prtg	UTSW	9	72856865	missense	probably damaging	1.00
FR4737:Prtg	UTSW	9	72857081	critical splice donor site	probably benign
R0130:Prtg	UTSW	9	72809716	missense	probably damaging	1.00
R0321:Prtg	UTSW	9	72848025	missense	possibly damaging	0.83
R0390:Prtg	UTSW	9	72844958	missense	probably benign	0.24
R0900:Prtg	UTSW	9	72844943	missense	probably benign
R1121:Prtg	UTSW	9	72906167	missense	probably benign	0.15
R1438:Prtg	UTSW	9	72910750	splice site	probably benign
R1537:Prtg	UTSW	9	72809757	missense	probably benign	0.00
R1590:Prtg	UTSW	9	72842807	missense	probably benign
R1626:Prtg	UTSW	9	72844911	missense	probably damaging	1.00
R1965:Prtg	UTSW	9	72848322	missense	probably benign	0.27
R1993:Prtg	UTSW	9	72844896	missense	probably benign
R2351:Prtg	UTSW	9	72856824	missense	probably damaging	1.00
R3737:Prtg	UTSW	9	72842709	nonsense	probably null
R3921:Prtg	UTSW	9	72848347	missense	probably damaging	0.98
R4035:Prtg	UTSW	9	72842709	nonsense	probably null
R4378:Prtg	UTSW	9	72842760	missense	possibly damaging	0.91
R4687:Prtg	UTSW	9	72890798	missense	probably damaging	1.00
R5469:Prtg	UTSW	9	72891965	missense	probably damaging	0.98
R5556:Prtg	UTSW	9	72851704	missense	probably damaging	1.00
R5563:Prtg	UTSW	9	72856898	missense	probably damaging	1.00
R5710:Prtg	UTSW	9	72809640	missense	probably damaging	1.00
R5738:Prtg	UTSW	9	72912006	missense	probably benign	0.16
R5868:Prtg	UTSW	9	72809717	nonsense	probably null
R5961:Prtg	UTSW	9	72856946	missense	probably benign
R5964:Prtg	UTSW	9	72892254	missense	probably benign	0.41
R6217:Prtg	UTSW	9	72904794	missense	probably damaging	1.00
R6306:Prtg	UTSW	9	72906186	missense	probably benign	0.42
R6395:Prtg	UTSW	9	72912132	missense	possibly damaging	0.80
R6455:Prtg	UTSW	9	72907856	missense	probably damaging	1.00
R6673:Prtg	UTSW	9	72851682	missense	probably damaging	0.99
R6985:Prtg	UTSW	9	72851501	missense	probably damaging	1.00
R7014:Prtg	UTSW	9	72891985	missense	possibly damaging	0.95
R7233:Prtg	UTSW	9	72911991	missense	probably benign	0.00
R7261:Prtg	UTSW	9	72907835	missense	possibly damaging	0.94
R7324:Prtg	UTSW	9	72890840	missense	probably damaging	0.96
R7372:Prtg	UTSW	9	72851566	nonsense	probably null
R7808:Prtg	UTSW	9	72842697	missense	possibly damaging	0.81
R8069:Prtg	UTSW	9	72844983	missense	probably benign	0.10
R8262:Prtg	UTSW	9	72906238	missense	probably benign	0.00
R8280:Prtg	UTSW	9	72906151	missense	probably damaging	0.99
R8290:Prtg	UTSW	9	72890795	missense	probably damaging	1.00
R8511:Prtg	UTSW	9	72890874	critical splice donor site	probably null
R8773:Prtg	UTSW	9	72912301	makesense	probably null
R9020:Prtg	UTSW	9	72891995	missense	probably damaging	0.98
R9104:Prtg	UTSW	9	72848325	missense	probably damaging	1.00
R9166:Prtg	UTSW	9	72856825	missense	probably damaging	1.00
R9186:Prtg	UTSW	9	72856877	missense	probably benign	0.34
R9256:Prtg	UTSW	9	72851695	missense	probably damaging	0.99
R9277:Prtg	UTSW	9	72809647	missense	probably benign	0.02
R9383:Prtg	UTSW	9	72849861	missense	probably benign	0.39
R9564:Prtg	UTSW	9	72858871	missense	probably damaging	0.99
R9644:Prtg	UTSW	9	72906211	missense	probably damaging	0.99
R9700:Prtg	UTSW	9	72855031	missense	probably benign
X0028:Prtg	UTSW	9	72851716	missense	possibly damaging	0.55
X0064:Prtg	UTSW	9	72904892	splice site	probably null
Z1176:Prtg	UTSW	9	72893968	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGACAGTCCATTTATGACATGC -3'
(R):5'- GTGCAGCATCCCCATCAGAATC -3'

Sequencing Primer
(F):5'- GTTTGAATTGAACTCAGACATCCGCC -3'
(R):5'- ACCAGCGAGGGGATTCG -3'

Posted On

2022-05-16