Mutagenetix > Incidental Mutation

Incidental Mutation 'R9402:Snx14'

711297

Institutional Source

Beutler Lab

Gene Symbol

Snx14

Ensembl Gene

ENSMUSG00000032422

Gene Name

sorting nexin 14

Synonyms

C330035N22Rik, YR-14

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9402 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88376750-88438958 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 88407437 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 254 (G254D)

Ref Sequence

ENSEMBL: ENSMUSP00000130116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000126405] [ENSMUST00000165315] [ENSMUST00000173011] [ENSMUST00000173039] [ENSMUST00000174806]

AlphaFold

Q8BHY8

Predicted Effect

probably benign
Transcript: ENSMUST00000126405

SMART Domains

Protein: ENSMUSP00000116773
Gene: ENSMUSG00000032422

Domain	Start	End	E-Value	Type
transmembrane domain	57	76	N/A	INTRINSIC
transmembrane domain	80	102	N/A	INTRINSIC
Pfam:PXA	157	210	3.9e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000165315
AA Change: G254D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130116
Gene: ENSMUSG00000032422
AA Change: G254D

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	157	330	8.2e-49	PFAM
Pfam:RGS	363	495	4.3e-13	PFAM
PX	585	704	8.77e-13	SMART
low complexity region	771	785	N/A	INTRINSIC
Pfam:Nexin_C	825	930	2e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000173011
AA Change: G254D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133507
Gene: ENSMUSG00000032422
AA Change: G254D

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	157	330	3.1e-49	PFAM
Pfam:RGS	363	482	3.1e-9	PFAM
low complexity region	499	513	N/A	INTRINSIC
Pfam:Nexin_C	553	658	7.2e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000173039
AA Change: G210D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133624
Gene: ENSMUSG00000032422
AA Change: G210D

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	154	286	6.5e-33	PFAM
Pfam:RGS	319	451	2.6e-13	PFAM
PX	541	660	8.77e-13	SMART
low complexity region	727	741	N/A	INTRINSIC
Pfam:Nexin_C	781	886	1.1e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173131

SMART Domains

Protein: ENSMUSP00000134122
Gene: ENSMUSG00000092541

Domain	Start	End	E-Value	Type
low complexity region	1	26	N/A	INTRINSIC
low complexity region	30	58	N/A	INTRINSIC
low complexity region	62	88	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174806
AA Change: G254D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133533
Gene: ENSMUSG00000032422
AA Change: G254D

Domain	Start	End	E-Value	Type
transmembrane domain	54	73	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
Pfam:PXA	158	327	1.9e-44	PFAM
Pfam:RGS	363	495	1.3e-13	PFAM
PX	594	713	8.77e-13	SMART
low complexity region	780	794	N/A	INTRINSIC
Pfam:Nexin_C	834	938	2.8e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family have a phox (PX) phosphoinositide binding domain and are involved in intracellular trafficking. The encoded protein also contains a regulator of G protein signaling (RGS) domain. Regulator of G protein signaling family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. Alternate splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	G	1: 136,227,610	S86R	probably benign	Het
Abca9	T	A	11: 110,158,328	Q218L	probably benign	Het
Atg2b	A	G	12: 105,648,423	F1083S	probably damaging	Het
Bche	T	C	3: 73,701,323	N257D	probably benign	Het
Cfap221	T	A	1: 119,932,821	M692L	probably benign	Het
Cfap46	G	T	7: 139,635,949	P1530Q	unknown	Het
Crim1	CCGC	CC	17: 78,350,865		probably null	Het
Cyp4f39	T	C	17: 32,491,209		probably null	Het
Daam1	A	G	12: 71,959,830	T674A	probably benign	Het
Elp2	A	T	18: 24,626,163	I526L	probably benign	Het
Exoc4	T	A	6: 33,476,143	*523K	probably null	Het
Fbxl7	G	A	15: 26,552,503	S226L	probably damaging	Het
Fry	G	A	5: 150,433,696	E1903K	possibly damaging	Het
Fry	G	A	5: 150,436,853	R1988K	probably damaging	Het
Gas1	A	T	13: 60,176,202	M206K	probably damaging	Het
Gbp10	T	A	5: 105,233,997	T96S	possibly damaging	Het
Gm14569	G	A	X: 36,430,896	P1387S	probably damaging	Het
Gpaa1	A	G	15: 76,332,218	T105A	probably benign	Het
Hoxc13	C	A	15: 102,921,616	C143*	probably null	Het
Htt	T	C	5: 34,848,980	I1411T	probably damaging	Het
Jmy	C	T	13: 93,499,170	C46Y	probably damaging	Het
Klhl40	A	G	9: 121,780,416	Y453C	possibly damaging	Het
Krit1	T	A	5: 3,822,210	Y460N	possibly damaging	Het
Lamb3	C	A	1: 193,331,396	T526K		Het
Lrrc29	T	A	8: 105,323,356	Y12F	probably benign	Het
Luzp1	T	A	4: 136,543,182	H905Q	probably damaging	Het
Lyst	T	A	13: 13,637,878	H958Q	probably benign	Het
Magi1	T	C	6: 94,283,297	N9S	probably benign	Het
Mmadhc	A	T	2: 50,281,107	V231E	probably benign	Het
Muc5b	T	A	7: 141,845,414	M364K	unknown	Het
Nae1	A	G	8: 104,528,185		probably null	Het
Ndst4	C	T	3: 125,724,736	S354L	probably benign	Het
Nlgn2	A	G	11: 69,828,107	F252S		Het
Nlrp9a	A	T	7: 26,570,605	N874I	possibly damaging	Het
Nodal	T	C	10: 61,423,600	I272T	probably damaging	Het
Olfr1234	C	A	2: 89,362,779	G217*	probably null	Het
Olfr1259	A	T	2: 89,943,940	Y58*	probably null	Het
Olfr599	T	C	7: 103,338,989	S312P	probably benign	Het
Olfr645	G	A	7: 104,084,403	R226*	probably null	Het
Orm1	C	A	4: 63,345,132	Q61K	possibly damaging	Het
Pcdh17	T	C	14: 84,447,206	V371A	probably damaging	Het
Pcdhb19	C	T	18: 37,499,479	Q776*	probably null	Het
Phf14	A	G	6: 11,933,780	R214G	possibly damaging	Het
Phf3	G	A	1: 30,811,847	T1142M	probably damaging	Het
Pigz	A	G	16: 31,945,369	E415G	probably damaging	Het
Pramel5	T	C	4: 144,271,456	T406A	probably benign	Het
Prtg	A	G	9: 72,911,971	E1082G	probably benign	Het
Rtp3	A	G	9: 110,985,963	C445R	unknown	Het
Scn3b	A	T	9: 40,282,556	E193V	probably damaging	Het
Scn7a	A	T	2: 66,680,112	N1315K	probably damaging	Het
Srbd1	T	C	17: 86,099,277	D560G	probably benign	Het
Srp72	T	A	5: 76,976,482	L65*	probably null	Het
Steap1	T	A	5: 5,740,664	I95F		Het
Taf3	A	G	2: 9,951,112		probably null	Het
Taok2	T	C	7: 126,870,228	N1143D		Het
Tas2r114	C	T	6: 131,689,931	G45S	possibly damaging	Het
Tcerg1l	T	C	7: 138,209,822	K548E	probably damaging	Het
Tcp1	T	A	17: 12,922,618	L328Q	probably benign	Het
Tns2	A	G	15: 102,113,188	H1096R	probably damaging	Het
Trps1	A	T	15: 50,846,256	Y233N	probably damaging	Het
Tubgcp6	A	G	15: 89,102,861	V1303A	probably benign	Het
Ugt1a2	T	C	1: 88,200,962	F109S	possibly damaging	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Zfp748	A	G	13: 67,545,392	V54A	probably benign	Het

Other mutations in Snx14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Snx14	APN	9	88402190	missense	probably damaging	0.99
IGL00773:Snx14	APN	9	88394539	missense	probably damaging	0.96
IGL00847:Snx14	APN	9	88420329	missense	probably damaging	1.00
IGL01526:Snx14	APN	9	88381500	missense	probably damaging	0.99
IGL01662:Snx14	APN	9	88385838	splice site	probably benign
IGL01928:Snx14	APN	9	88381512	missense	probably benign	0.04
IGL02225:Snx14	APN	9	88413524	missense	probably damaging	0.99
IGL02498:Snx14	APN	9	88407464	missense	probably damaging	1.00
IGL02585:Snx14	APN	9	88404518	missense	possibly damaging	0.92
IGL02634:Snx14	APN	9	88403303	missense	probably damaging	1.00
IGL03073:Snx14	APN	9	88422896	critical splice donor site	probably null
R0167:Snx14	UTSW	9	88407416	missense	probably damaging	1.00
R0324:Snx14	UTSW	9	88405238	critical splice donor site	probably null
R0627:Snx14	UTSW	9	88394430	missense	probably benign
R0862:Snx14	UTSW	9	88383996	missense	possibly damaging	0.81
R0864:Snx14	UTSW	9	88383996	missense	possibly damaging	0.81
R0973:Snx14	UTSW	9	88400721	critical splice donor site	probably null
R0973:Snx14	UTSW	9	88400721	critical splice donor site	probably null
R0974:Snx14	UTSW	9	88400721	critical splice donor site	probably null
R1478:Snx14	UTSW	9	88394528	missense	probably benign	0.00
R1511:Snx14	UTSW	9	88398364	nonsense	probably null
R1522:Snx14	UTSW	9	88402224	missense	possibly damaging	0.52
R1612:Snx14	UTSW	9	88376905	missense	possibly damaging	0.81
R1634:Snx14	UTSW	9	88385739	missense	probably benign	0.00
R1634:Snx14	UTSW	9	88407490	splice site	probably benign
R1704:Snx14	UTSW	9	88413538	missense	probably damaging	1.00
R1713:Snx14	UTSW	9	88415675	missense	probably damaging	1.00
R1883:Snx14	UTSW	9	88402261	missense	probably benign	0.01
R3701:Snx14	UTSW	9	88420243	splice site	probably benign
R3853:Snx14	UTSW	9	88407319	splice site	probably benign
R4301:Snx14	UTSW	9	88410623	missense	probably damaging	1.00
R4449:Snx14	UTSW	9	88422999	missense	probably benign	0.05
R4793:Snx14	UTSW	9	88394442	missense	probably damaging	0.98
R4934:Snx14	UTSW	9	88398288	missense	probably damaging	0.98
R5126:Snx14	UTSW	9	88382099	missense	probably damaging	1.00
R5227:Snx14	UTSW	9	88398294	missense	possibly damaging	0.77
R5518:Snx14	UTSW	9	88383802	missense	probably damaging	1.00
R5838:Snx14	UTSW	9	88391776	missense	probably damaging	1.00
R5957:Snx14	UTSW	9	88403274	missense	possibly damaging	0.84
R6153:Snx14	UTSW	9	88391806	missense	probably damaging	1.00
R6156:Snx14	UTSW	9	88407339	missense	possibly damaging	0.92
R6703:Snx14	UTSW	9	88422914	missense	probably damaging	0.96
R6784:Snx14	UTSW	9	88381792	missense	probably benign	0.01
R6823:Snx14	UTSW	9	88394382	missense	possibly damaging	0.90
R6837:Snx14	UTSW	9	88380223	missense	probably benign	0.07
R7169:Snx14	UTSW	9	88398309	missense	probably damaging	0.98
R7216:Snx14	UTSW	9	88381791	missense	probably damaging	0.99
R7224:Snx14	UTSW	9	88394561	missense	possibly damaging	0.92
R7357:Snx14	UTSW	9	88404316	missense	possibly damaging	0.49
R7738:Snx14	UTSW	9	88407474	missense	probably benign	0.00
R7743:Snx14	UTSW	9	88398349	missense	probably benign	0.01
R7969:Snx14	UTSW	9	88413560	missense	probably damaging	1.00
R8016:Snx14	UTSW	9	88415687	missense	probably damaging	0.99
R8384:Snx14	UTSW	9	88403280	nonsense	probably null
R8492:Snx14	UTSW	9	88381816	missense	possibly damaging	0.94
R8686:Snx14	UTSW	9	88415693	missense	probably damaging	1.00
R8738:Snx14	UTSW	9	88407400	missense	possibly damaging	0.93
R8870:Snx14	UTSW	9	88413488	missense	probably benign	0.01
R9208:Snx14	UTSW	9	88383779	missense	probably benign	0.01
R9620:Snx14	UTSW	9	88381741	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTAATTATTCTTTCCAGCTGGACAG -3'
(R):5'- TTCATGGGAGAGGAGAAAGTCTTC -3'

Sequencing Primer
(F):5'- AGTATGCTCAAAGTGTTTCTGTC -3'
(R):5'- GAGAGGAGAAAGTCTTCCTTTATGTC -3'

Posted On

2022-05-16