Incidental Mutation 'R9402:Nodal'
ID 711300
Institutional Source Beutler Lab
Gene Symbol Nodal
Ensembl Gene ENSMUSG00000037171
Gene Name nodal
Synonyms Tg.413d
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9402 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 61253751-61261117 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 61259379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 272 (I272T)
Ref Sequence ENSEMBL: ENSMUSP00000039653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020288] [ENSMUST00000049339]
AlphaFold P43021
Predicted Effect probably benign
Transcript: ENSMUST00000020288
SMART Domains Protein: ENSMUSP00000020288
Gene: ENSMUSG00000020091

DomainStartEndE-ValueType
Pfam:eIF_4EBP 1 120 4.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000049339
AA Change: I272T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039653
Gene: ENSMUSG00000037171
AA Change: I272T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
TGFB 254 354 2.6e-58 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which regulates early embryonic development. Homozygous knockout mice for this gene exhibit early embryonic lethality, while expression of a hypomorphic allele results in defects in anteroposterior and left-right patterning. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mutants fail to form a primitive streak, show placental defects and die at gastrulation. Hypomorphic mutants are defective in anterior-posterior, anterior-midline, and left-right body patterning, resulting in multiple organ defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,049,154 (GRCm39) Q218L probably benign Het
Atg2b A G 12: 105,614,682 (GRCm39) F1083S probably damaging Het
Bche T C 3: 73,608,656 (GRCm39) N257D probably benign Het
Cfap221 T A 1: 119,860,551 (GRCm39) M692L probably benign Het
Cfap46 G T 7: 139,215,865 (GRCm39) P1530Q unknown Het
Crim1 CCGC CC 17: 78,658,294 (GRCm39) probably null Het
Cyp4f39 T C 17: 32,710,183 (GRCm39) probably null Het
Daam1 A G 12: 72,006,604 (GRCm39) T674A probably benign Het
Elp2 A T 18: 24,759,220 (GRCm39) I526L probably benign Het
Exoc4 T A 6: 33,453,078 (GRCm39) *523K probably null Het
Fbxl7 G A 15: 26,552,589 (GRCm39) S226L probably damaging Het
Fbxl9 T A 8: 106,049,988 (GRCm39) Y12F probably benign Het
Fry G A 5: 150,357,161 (GRCm39) E1903K possibly damaging Het
Fry G A 5: 150,360,318 (GRCm39) R1988K probably damaging Het
Gas1 A T 13: 60,324,016 (GRCm39) M206K probably damaging Het
Gbp10 T A 5: 105,381,863 (GRCm39) T96S possibly damaging Het
Gm14569 G A X: 35,694,549 (GRCm39) P1387S probably damaging Het
Gpaa1 A G 15: 76,216,418 (GRCm39) T105A probably benign Het
Hoxc13 C A 15: 102,830,051 (GRCm39) C143* probably null Het
Htt T C 5: 35,006,324 (GRCm39) I1411T probably damaging Het
Inava T G 1: 136,155,348 (GRCm39) S86R probably benign Het
Jmy C T 13: 93,635,678 (GRCm39) C46Y probably damaging Het
Klhl40 A G 9: 121,609,482 (GRCm39) Y453C possibly damaging Het
Krit1 T A 5: 3,872,210 (GRCm39) Y460N possibly damaging Het
Lamb3 C A 1: 193,013,704 (GRCm39) T526K Het
Luzp1 T A 4: 136,270,493 (GRCm39) H905Q probably damaging Het
Lyst T A 13: 13,812,463 (GRCm39) H958Q probably benign Het
Magi1 T C 6: 94,260,278 (GRCm39) N9S probably benign Het
Mmadhc A T 2: 50,171,119 (GRCm39) V231E probably benign Het
Muc5b T A 7: 141,399,151 (GRCm39) M364K unknown Het
Nae1 A G 8: 105,254,817 (GRCm39) probably null Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Nlgn2 A G 11: 69,718,933 (GRCm39) F252S Het
Nlrp9a A T 7: 26,270,030 (GRCm39) N874I possibly damaging Het
Or4a15 C A 2: 89,193,123 (GRCm39) G217* probably null Het
Or4c12 A T 2: 89,774,284 (GRCm39) Y58* probably null Het
Or51a24 G A 7: 103,733,610 (GRCm39) R226* probably null Het
Or52ab4 T C 7: 102,988,196 (GRCm39) S312P probably benign Het
Orm1 C A 4: 63,263,369 (GRCm39) Q61K possibly damaging Het
Pcdh17 T C 14: 84,684,646 (GRCm39) V371A probably damaging Het
Pcdhb19 C T 18: 37,632,532 (GRCm39) Q776* probably null Het
Phf14 A G 6: 11,933,779 (GRCm39) R214G possibly damaging Het
Phf3 G A 1: 30,850,928 (GRCm39) T1142M probably damaging Het
Pigz A G 16: 31,764,187 (GRCm39) E415G probably damaging Het
Pramel5 T C 4: 143,998,026 (GRCm39) T406A probably benign Het
Prtg A G 9: 72,819,253 (GRCm39) E1082G probably benign Het
Rtp3 A G 9: 110,815,031 (GRCm39) C445R unknown Het
Scn3b A T 9: 40,193,852 (GRCm39) E193V probably damaging Het
Scn7a A T 2: 66,510,456 (GRCm39) N1315K probably damaging Het
Snx14 C T 9: 88,289,490 (GRCm39) G254D probably damaging Het
Srbd1 T C 17: 86,406,705 (GRCm39) D560G probably benign Het
Srp72 T A 5: 77,124,329 (GRCm39) L65* probably null Het
Steap1 T A 5: 5,790,664 (GRCm39) I95F Het
Taf3 A G 2: 9,955,923 (GRCm39) probably null Het
Taok2 T C 7: 126,469,400 (GRCm39) N1143D Het
Tas2r114 C T 6: 131,666,894 (GRCm39) G45S possibly damaging Het
Tcerg1l T C 7: 137,811,551 (GRCm39) K548E probably damaging Het
Tcp1 T A 17: 13,141,505 (GRCm39) L328Q probably benign Het
Tns2 A G 15: 102,021,623 (GRCm39) H1096R probably damaging Het
Trps1 A T 15: 50,709,652 (GRCm39) Y233N probably damaging Het
Tubgcp6 A G 15: 88,987,064 (GRCm39) V1303A probably benign Het
Ugt1a2 T C 1: 88,128,684 (GRCm39) F109S possibly damaging Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Zfp748 A G 13: 67,693,511 (GRCm39) V54A probably benign Het
Other mutations in Nodal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Nodal APN 10 61,254,176 (GRCm39) missense probably benign 0.00
IGL02153:Nodal APN 10 61,260,324 (GRCm39) missense probably damaging 1.00
R1540:Nodal UTSW 10 61,258,764 (GRCm39) missense probably damaging 0.96
R1993:Nodal UTSW 10 61,254,113 (GRCm39) missense probably benign 0.05
R2086:Nodal UTSW 10 61,259,077 (GRCm39) missense possibly damaging 0.76
R2317:Nodal UTSW 10 61,254,212 (GRCm39) missense possibly damaging 0.83
R3110:Nodal UTSW 10 61,260,276 (GRCm39) missense possibly damaging 0.75
R3112:Nodal UTSW 10 61,260,276 (GRCm39) missense possibly damaging 0.75
R3973:Nodal UTSW 10 61,258,833 (GRCm39) missense probably benign
R5785:Nodal UTSW 10 61,259,456 (GRCm39) missense probably damaging 1.00
R5967:Nodal UTSW 10 61,259,446 (GRCm39) missense probably damaging 0.99
R6166:Nodal UTSW 10 61,260,337 (GRCm39) missense probably damaging 1.00
R6212:Nodal UTSW 10 61,259,300 (GRCm39) missense possibly damaging 0.82
R6238:Nodal UTSW 10 61,259,258 (GRCm39) missense probably damaging 0.96
R9145:Nodal UTSW 10 61,259,459 (GRCm39) missense probably damaging 1.00
X0026:Nodal UTSW 10 61,260,339 (GRCm39) missense probably damaging 1.00
Z1177:Nodal UTSW 10 61,254,154 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TACTCCAACCGGCCTCAGG -3'
(R):5'- AGAGCGCCCTCTCCCAATG -3'

Sequencing Primer
(F):5'- TAGGGGGCGCCACTTTG -3'
(R):5'- CCTCTCCCAATGCTTGAACAC -3'
Posted On 2022-05-16