Mutagenetix > Incidental Mutation

Incidental Mutation 'R9402:Atg2b'

711304

Institutional Source

Beutler Lab

Gene Symbol

Atg2b

Ensembl Gene

ENSMUSG00000041341

Gene Name

autophagy related 2B

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.200) question?

Stock #

R9402 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105616136-105685211 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105648423 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1083 (F1083S)

Ref Sequence

ENSEMBL: ENSMUSP00000037441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041055]

AlphaFold

Q80XK6

Predicted Effect

probably damaging
Transcript: ENSMUST00000041055
AA Change: F1083S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341
AA Change: F1083S

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	11	127	3.5e-19	PFAM
low complexity region	286	298	N/A	INTRINSIC
low complexity region	409	428	N/A	INTRINSIC
low complexity region	864	870	N/A	INTRINSIC
low complexity region	893	904	N/A	INTRINSIC
low complexity region	1722	1733	N/A	INTRINSIC
Pfam:ATG_C	1976	2071	1.4e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000221015

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	G	1: 136,227,610	S86R	probably benign	Het
Abca9	T	A	11: 110,158,328	Q218L	probably benign	Het
Bche	T	C	3: 73,701,323	N257D	probably benign	Het
Cfap221	T	A	1: 119,932,821	M692L	probably benign	Het
Cfap46	G	T	7: 139,635,949	P1530Q	unknown	Het
Crim1	CCGC	CC	17: 78,350,865		probably null	Het
Cyp4f39	T	C	17: 32,491,209		probably null	Het
Daam1	A	G	12: 71,959,830	T674A	probably benign	Het
Elp2	A	T	18: 24,626,163	I526L	probably benign	Het
Exoc4	T	A	6: 33,476,143	*523K	probably null	Het
Fbxl7	G	A	15: 26,552,503	S226L	probably damaging	Het
Fry	G	A	5: 150,433,696	E1903K	possibly damaging	Het
Fry	G	A	5: 150,436,853	R1988K	probably damaging	Het
Gas1	A	T	13: 60,176,202	M206K	probably damaging	Het
Gbp10	T	A	5: 105,233,997	T96S	possibly damaging	Het
Gm14569	G	A	X: 36,430,896	P1387S	probably damaging	Het
Gpaa1	A	G	15: 76,332,218	T105A	probably benign	Het
Hoxc13	C	A	15: 102,921,616	C143*	probably null	Het
Htt	T	C	5: 34,848,980	I1411T	probably damaging	Het
Jmy	C	T	13: 93,499,170	C46Y	probably damaging	Het
Klhl40	A	G	9: 121,780,416	Y453C	possibly damaging	Het
Krit1	T	A	5: 3,822,210	Y460N	possibly damaging	Het
Lamb3	C	A	1: 193,331,396	T526K		Het
Lrrc29	T	A	8: 105,323,356	Y12F	probably benign	Het
Luzp1	T	A	4: 136,543,182	H905Q	probably damaging	Het
Lyst	T	A	13: 13,637,878	H958Q	probably benign	Het
Magi1	T	C	6: 94,283,297	N9S	probably benign	Het
Mmadhc	A	T	2: 50,281,107	V231E	probably benign	Het
Muc5b	T	A	7: 141,845,414	M364K	unknown	Het
Nae1	A	G	8: 104,528,185		probably null	Het
Ndst4	C	T	3: 125,724,736	S354L	probably benign	Het
Nlgn2	A	G	11: 69,828,107	F252S		Het
Nlrp9a	A	T	7: 26,570,605	N874I	possibly damaging	Het
Nodal	T	C	10: 61,423,600	I272T	probably damaging	Het
Olfr1234	C	A	2: 89,362,779	G217*	probably null	Het
Olfr1259	A	T	2: 89,943,940	Y58*	probably null	Het
Olfr599	T	C	7: 103,338,989	S312P	probably benign	Het
Olfr645	G	A	7: 104,084,403	R226*	probably null	Het
Orm1	C	A	4: 63,345,132	Q61K	possibly damaging	Het
Pcdh17	T	C	14: 84,447,206	V371A	probably damaging	Het
Pcdhb19	C	T	18: 37,499,479	Q776*	probably null	Het
Phf14	A	G	6: 11,933,780	R214G	possibly damaging	Het
Phf3	G	A	1: 30,811,847	T1142M	probably damaging	Het
Pigz	A	G	16: 31,945,369	E415G	probably damaging	Het
Pramel5	T	C	4: 144,271,456	T406A	probably benign	Het
Prtg	A	G	9: 72,911,971	E1082G	probably benign	Het
Rtp3	A	G	9: 110,985,963	C445R	unknown	Het
Scn3b	A	T	9: 40,282,556	E193V	probably damaging	Het
Scn7a	A	T	2: 66,680,112	N1315K	probably damaging	Het
Snx14	C	T	9: 88,407,437	G254D	probably damaging	Het
Srbd1	T	C	17: 86,099,277	D560G	probably benign	Het
Srp72	T	A	5: 76,976,482	L65*	probably null	Het
Steap1	T	A	5: 5,740,664	I95F		Het
Taf3	A	G	2: 9,951,112		probably null	Het
Taok2	T	C	7: 126,870,228	N1143D		Het
Tas2r114	C	T	6: 131,689,931	G45S	possibly damaging	Het
Tcerg1l	T	C	7: 138,209,822	K548E	probably damaging	Het
Tcp1	T	A	17: 12,922,618	L328Q	probably benign	Het
Tns2	A	G	15: 102,113,188	H1096R	probably damaging	Het
Trps1	A	T	15: 50,846,256	Y233N	probably damaging	Het
Tubgcp6	A	G	15: 89,102,861	V1303A	probably benign	Het
Ugt1a2	T	C	1: 88,200,962	F109S	possibly damaging	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Zfp748	A	G	13: 67,545,392	V54A	probably benign	Het

Other mutations in Atg2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Atg2b	APN	12	105644916	missense	probably benign	0.20
IGL01326:Atg2b	APN	12	105622144	missense	probably damaging	1.00
IGL02063:Atg2b	APN	12	105648322	missense	possibly damaging	0.89
IGL02260:Atg2b	APN	12	105636440	splice site	probably benign
IGL02376:Atg2b	APN	12	105645468	missense	probably damaging	1.00
IGL02381:Atg2b	APN	12	105648348	missense	probably damaging	1.00
IGL02434:Atg2b	APN	12	105639207	missense	probably benign	0.00
IGL02534:Atg2b	APN	12	105643267	missense	probably damaging	1.00
IGL03011:Atg2b	APN	12	105626362	missense	probably damaging	0.98
IGL03173:Atg2b	APN	12	105658294	missense	possibly damaging	0.68
R6669_atg2b_067	UTSW	12	105671529	missense	possibly damaging	0.90
rail	UTSW	12	105658840	nonsense	probably null
Sora	UTSW	12	105623430	missense	probably benign	0.06
R0066:Atg2b	UTSW	12	105648449	missense	probably benign
R0066:Atg2b	UTSW	12	105648449	missense	probably benign
R0511:Atg2b	UTSW	12	105617153	missense	probably damaging	1.00
R0762:Atg2b	UTSW	12	105674970	missense	possibly damaging	0.56
R0786:Atg2b	UTSW	12	105636508	missense	probably benign	0.00
R1029:Atg2b	UTSW	12	105635773	missense	probably damaging	0.96
R1529:Atg2b	UTSW	12	105661133	missense	probably benign
R1563:Atg2b	UTSW	12	105623488	missense	probably damaging	0.99
R1746:Atg2b	UTSW	12	105669329	missense	possibly damaging	0.79
R1887:Atg2b	UTSW	12	105654092	missense	probably benign	0.01
R1956:Atg2b	UTSW	12	105669418	missense	probably damaging	1.00
R1957:Atg2b	UTSW	12	105669418	missense	probably damaging	1.00
R2272:Atg2b	UTSW	12	105638008	missense	probably benign	0.00
R2877:Atg2b	UTSW	12	105664009	nonsense	probably null
R2878:Atg2b	UTSW	12	105664009	nonsense	probably null
R4798:Atg2b	UTSW	12	105652629	missense	probably benign	0.37
R4836:Atg2b	UTSW	12	105646814	missense	probably benign
R5007:Atg2b	UTSW	12	105643876	splice site	probably null
R5042:Atg2b	UTSW	12	105621262	missense	probably benign	0.01
R5134:Atg2b	UTSW	12	105674950	missense	probably damaging	0.96
R5212:Atg2b	UTSW	12	105646796	missense	probably benign	0.00
R5250:Atg2b	UTSW	12	105635765	missense	probably damaging	1.00
R5307:Atg2b	UTSW	12	105658329	missense	probably benign	0.17
R5342:Atg2b	UTSW	12	105658916	missense	possibly damaging	0.90
R5583:Atg2b	UTSW	12	105649155	missense	possibly damaging	0.94
R5656:Atg2b	UTSW	12	105621328	missense	probably benign	0.00
R5660:Atg2b	UTSW	12	105649124	nonsense	probably null
R5903:Atg2b	UTSW	12	105639359	missense	possibly damaging	0.90
R6018:Atg2b	UTSW	12	105661171	missense	probably damaging	0.96
R6153:Atg2b	UTSW	12	105623482	missense	possibly damaging	0.80
R6326:Atg2b	UTSW	12	105661092	nonsense	probably null
R6584:Atg2b	UTSW	12	105657995	missense	probably damaging	1.00
R6593:Atg2b	UTSW	12	105644848	missense	probably damaging	1.00
R6669:Atg2b	UTSW	12	105671529	missense	possibly damaging	0.90
R6847:Atg2b	UTSW	12	105635788	missense	probably damaging	1.00
R7003:Atg2b	UTSW	12	105654249	missense	probably benign	0.01
R7193:Atg2b	UTSW	12	105664708	missense	probably damaging	1.00
R7387:Atg2b	UTSW	12	105622775	missense	probably damaging	1.00
R7432:Atg2b	UTSW	12	105661204	missense	probably damaging	0.98
R7432:Atg2b	UTSW	12	105664698	missense	probably benign	0.08
R7630:Atg2b	UTSW	12	105646954	critical splice acceptor site	probably null
R7634:Atg2b	UTSW	12	105652120	missense	probably damaging	1.00
R7645:Atg2b	UTSW	12	105623430	missense	probably benign	0.06
R7653:Atg2b	UTSW	12	105636472	missense	possibly damaging	0.68
R8157:Atg2b	UTSW	12	105662940	missense	probably damaging	1.00
R8222:Atg2b	UTSW	12	105652216	missense	possibly damaging	0.95
R8469:Atg2b	UTSW	12	105637911	missense	probably benign	0.00
R8708:Atg2b	UTSW	12	105669428	critical splice acceptor site	probably benign
R8784:Atg2b	UTSW	12	105639241	missense	probably damaging	1.00
R8975:Atg2b	UTSW	12	105636466	missense	probably damaging	1.00
R8988:Atg2b	UTSW	12	105617129	missense	probably damaging	0.97
R9071:Atg2b	UTSW	12	105658840	nonsense	probably null
R9269:Atg2b	UTSW	12	105652100	missense	probably damaging	1.00
R9355:Atg2b	UTSW	12	105670721	missense	possibly damaging	0.48
R9492:Atg2b	UTSW	12	105658290	missense	probably benign	0.06
R9709:Atg2b	UTSW	12	105644881	missense	probably damaging	1.00
R9717:Atg2b	UTSW	12	105639302	missense	probably benign
R9746:Atg2b	UTSW	12	105663938	missense	possibly damaging	0.84
X0018:Atg2b	UTSW	12	105666697	missense	possibly damaging	0.86
X0066:Atg2b	UTSW	12	105646785	missense	probably benign	0.12
Z1177:Atg2b	UTSW	12	105635764	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTCCTTAACAGATAGGAAATTCACTC -3'
(R):5'- GTCAGAATGAGCATGCCAAGAC -3'

Sequencing Primer
(F):5'- TTCACTCGCCAAACAGAGGAG -3'
(R):5'- TGAGCATGCCAAGACACATTCTTTC -3'

Posted On

2022-05-16