Incidental Mutation 'R9402:Atg2b'
ID 711304
Institutional Source Beutler Lab
Gene Symbol Atg2b
Ensembl Gene ENSMUSG00000041341
Gene Name autophagy related 2B
Synonyms C030004M05Rik, 2410024A21Rik, C630028L02Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R9402 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 105582395-105651470 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105614682 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1083 (F1083S)
Ref Sequence ENSEMBL: ENSMUSP00000037441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041055]
AlphaFold Q80XK6
Predicted Effect probably damaging
Transcript: ENSMUST00000041055
AA Change: F1083S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341
AA Change: F1083S

DomainStartEndE-ValueType
Pfam:Chorein_N 11 127 3.5e-19 PFAM
low complexity region 286 298 N/A INTRINSIC
low complexity region 409 428 N/A INTRINSIC
low complexity region 864 870 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
Pfam:ATG_C 1976 2071 1.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221015
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,049,154 (GRCm39) Q218L probably benign Het
Bche T C 3: 73,608,656 (GRCm39) N257D probably benign Het
Cfap221 T A 1: 119,860,551 (GRCm39) M692L probably benign Het
Cfap46 G T 7: 139,215,865 (GRCm39) P1530Q unknown Het
Crim1 CCGC CC 17: 78,658,294 (GRCm39) probably null Het
Cyp4f39 T C 17: 32,710,183 (GRCm39) probably null Het
Daam1 A G 12: 72,006,604 (GRCm39) T674A probably benign Het
Elp2 A T 18: 24,759,220 (GRCm39) I526L probably benign Het
Exoc4 T A 6: 33,453,078 (GRCm39) *523K probably null Het
Fbxl7 G A 15: 26,552,589 (GRCm39) S226L probably damaging Het
Fbxl9 T A 8: 106,049,988 (GRCm39) Y12F probably benign Het
Fry G A 5: 150,357,161 (GRCm39) E1903K possibly damaging Het
Fry G A 5: 150,360,318 (GRCm39) R1988K probably damaging Het
Gas1 A T 13: 60,324,016 (GRCm39) M206K probably damaging Het
Gbp10 T A 5: 105,381,863 (GRCm39) T96S possibly damaging Het
Gm14569 G A X: 35,694,549 (GRCm39) P1387S probably damaging Het
Gpaa1 A G 15: 76,216,418 (GRCm39) T105A probably benign Het
Hoxc13 C A 15: 102,830,051 (GRCm39) C143* probably null Het
Htt T C 5: 35,006,324 (GRCm39) I1411T probably damaging Het
Inava T G 1: 136,155,348 (GRCm39) S86R probably benign Het
Jmy C T 13: 93,635,678 (GRCm39) C46Y probably damaging Het
Klhl40 A G 9: 121,609,482 (GRCm39) Y453C possibly damaging Het
Krit1 T A 5: 3,872,210 (GRCm39) Y460N possibly damaging Het
Lamb3 C A 1: 193,013,704 (GRCm39) T526K Het
Luzp1 T A 4: 136,270,493 (GRCm39) H905Q probably damaging Het
Lyst T A 13: 13,812,463 (GRCm39) H958Q probably benign Het
Magi1 T C 6: 94,260,278 (GRCm39) N9S probably benign Het
Mmadhc A T 2: 50,171,119 (GRCm39) V231E probably benign Het
Muc5b T A 7: 141,399,151 (GRCm39) M364K unknown Het
Nae1 A G 8: 105,254,817 (GRCm39) probably null Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Nlgn2 A G 11: 69,718,933 (GRCm39) F252S Het
Nlrp9a A T 7: 26,270,030 (GRCm39) N874I possibly damaging Het
Nodal T C 10: 61,259,379 (GRCm39) I272T probably damaging Het
Or4a15 C A 2: 89,193,123 (GRCm39) G217* probably null Het
Or4c12 A T 2: 89,774,284 (GRCm39) Y58* probably null Het
Or51a24 G A 7: 103,733,610 (GRCm39) R226* probably null Het
Or52ab4 T C 7: 102,988,196 (GRCm39) S312P probably benign Het
Orm1 C A 4: 63,263,369 (GRCm39) Q61K possibly damaging Het
Pcdh17 T C 14: 84,684,646 (GRCm39) V371A probably damaging Het
Pcdhb19 C T 18: 37,632,532 (GRCm39) Q776* probably null Het
Phf14 A G 6: 11,933,779 (GRCm39) R214G possibly damaging Het
Phf3 G A 1: 30,850,928 (GRCm39) T1142M probably damaging Het
Pigz A G 16: 31,764,187 (GRCm39) E415G probably damaging Het
Pramel5 T C 4: 143,998,026 (GRCm39) T406A probably benign Het
Prtg A G 9: 72,819,253 (GRCm39) E1082G probably benign Het
Rtp3 A G 9: 110,815,031 (GRCm39) C445R unknown Het
Scn3b A T 9: 40,193,852 (GRCm39) E193V probably damaging Het
Scn7a A T 2: 66,510,456 (GRCm39) N1315K probably damaging Het
Snx14 C T 9: 88,289,490 (GRCm39) G254D probably damaging Het
Srbd1 T C 17: 86,406,705 (GRCm39) D560G probably benign Het
Srp72 T A 5: 77,124,329 (GRCm39) L65* probably null Het
Steap1 T A 5: 5,790,664 (GRCm39) I95F Het
Taf3 A G 2: 9,955,923 (GRCm39) probably null Het
Taok2 T C 7: 126,469,400 (GRCm39) N1143D Het
Tas2r114 C T 6: 131,666,894 (GRCm39) G45S possibly damaging Het
Tcerg1l T C 7: 137,811,551 (GRCm39) K548E probably damaging Het
Tcp1 T A 17: 13,141,505 (GRCm39) L328Q probably benign Het
Tns2 A G 15: 102,021,623 (GRCm39) H1096R probably damaging Het
Trps1 A T 15: 50,709,652 (GRCm39) Y233N probably damaging Het
Tubgcp6 A G 15: 88,987,064 (GRCm39) V1303A probably benign Het
Ugt1a2 T C 1: 88,128,684 (GRCm39) F109S possibly damaging Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Zfp748 A G 13: 67,693,511 (GRCm39) V54A probably benign Het
Other mutations in Atg2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Atg2b APN 12 105,611,175 (GRCm39) missense probably benign 0.20
IGL01326:Atg2b APN 12 105,588,403 (GRCm39) missense probably damaging 1.00
IGL02063:Atg2b APN 12 105,614,581 (GRCm39) missense possibly damaging 0.89
IGL02260:Atg2b APN 12 105,602,699 (GRCm39) splice site probably benign
IGL02376:Atg2b APN 12 105,611,727 (GRCm39) missense probably damaging 1.00
IGL02381:Atg2b APN 12 105,614,607 (GRCm39) missense probably damaging 1.00
IGL02434:Atg2b APN 12 105,605,466 (GRCm39) missense probably benign 0.00
IGL02534:Atg2b APN 12 105,609,526 (GRCm39) missense probably damaging 1.00
IGL03011:Atg2b APN 12 105,592,621 (GRCm39) missense probably damaging 0.98
IGL03173:Atg2b APN 12 105,624,553 (GRCm39) missense possibly damaging 0.68
R6669_atg2b_067 UTSW 12 105,637,788 (GRCm39) missense possibly damaging 0.90
rail UTSW 12 105,625,099 (GRCm39) nonsense probably null
Sora UTSW 12 105,589,689 (GRCm39) missense probably benign 0.06
R0066:Atg2b UTSW 12 105,614,708 (GRCm39) missense probably benign
R0066:Atg2b UTSW 12 105,614,708 (GRCm39) missense probably benign
R0511:Atg2b UTSW 12 105,583,412 (GRCm39) missense probably damaging 1.00
R0762:Atg2b UTSW 12 105,641,229 (GRCm39) missense possibly damaging 0.56
R0786:Atg2b UTSW 12 105,602,767 (GRCm39) missense probably benign 0.00
R1029:Atg2b UTSW 12 105,602,032 (GRCm39) missense probably damaging 0.96
R1529:Atg2b UTSW 12 105,627,392 (GRCm39) missense probably benign
R1563:Atg2b UTSW 12 105,589,747 (GRCm39) missense probably damaging 0.99
R1746:Atg2b UTSW 12 105,635,588 (GRCm39) missense possibly damaging 0.79
R1887:Atg2b UTSW 12 105,620,351 (GRCm39) missense probably benign 0.01
R1956:Atg2b UTSW 12 105,635,677 (GRCm39) missense probably damaging 1.00
R1957:Atg2b UTSW 12 105,635,677 (GRCm39) missense probably damaging 1.00
R2272:Atg2b UTSW 12 105,604,267 (GRCm39) missense probably benign 0.00
R2877:Atg2b UTSW 12 105,630,268 (GRCm39) nonsense probably null
R2878:Atg2b UTSW 12 105,630,268 (GRCm39) nonsense probably null
R4798:Atg2b UTSW 12 105,618,888 (GRCm39) missense probably benign 0.37
R4836:Atg2b UTSW 12 105,613,073 (GRCm39) missense probably benign
R5007:Atg2b UTSW 12 105,610,135 (GRCm39) splice site probably null
R5042:Atg2b UTSW 12 105,587,521 (GRCm39) missense probably benign 0.01
R5134:Atg2b UTSW 12 105,641,209 (GRCm39) missense probably damaging 0.96
R5212:Atg2b UTSW 12 105,613,055 (GRCm39) missense probably benign 0.00
R5250:Atg2b UTSW 12 105,602,024 (GRCm39) missense probably damaging 1.00
R5307:Atg2b UTSW 12 105,624,588 (GRCm39) missense probably benign 0.17
R5342:Atg2b UTSW 12 105,625,175 (GRCm39) missense possibly damaging 0.90
R5583:Atg2b UTSW 12 105,615,414 (GRCm39) missense possibly damaging 0.94
R5656:Atg2b UTSW 12 105,587,587 (GRCm39) missense probably benign 0.00
R5660:Atg2b UTSW 12 105,615,383 (GRCm39) nonsense probably null
R5903:Atg2b UTSW 12 105,605,618 (GRCm39) missense possibly damaging 0.90
R6018:Atg2b UTSW 12 105,627,430 (GRCm39) missense probably damaging 0.96
R6153:Atg2b UTSW 12 105,589,741 (GRCm39) missense possibly damaging 0.80
R6326:Atg2b UTSW 12 105,627,351 (GRCm39) nonsense probably null
R6584:Atg2b UTSW 12 105,624,254 (GRCm39) missense probably damaging 1.00
R6593:Atg2b UTSW 12 105,611,107 (GRCm39) missense probably damaging 1.00
R6669:Atg2b UTSW 12 105,637,788 (GRCm39) missense possibly damaging 0.90
R6847:Atg2b UTSW 12 105,602,047 (GRCm39) missense probably damaging 1.00
R7003:Atg2b UTSW 12 105,620,508 (GRCm39) missense probably benign 0.01
R7193:Atg2b UTSW 12 105,630,967 (GRCm39) missense probably damaging 1.00
R7387:Atg2b UTSW 12 105,589,034 (GRCm39) missense probably damaging 1.00
R7432:Atg2b UTSW 12 105,630,957 (GRCm39) missense probably benign 0.08
R7432:Atg2b UTSW 12 105,627,463 (GRCm39) missense probably damaging 0.98
R7630:Atg2b UTSW 12 105,613,213 (GRCm39) critical splice acceptor site probably null
R7634:Atg2b UTSW 12 105,618,379 (GRCm39) missense probably damaging 1.00
R7645:Atg2b UTSW 12 105,589,689 (GRCm39) missense probably benign 0.06
R7653:Atg2b UTSW 12 105,602,731 (GRCm39) missense possibly damaging 0.68
R8157:Atg2b UTSW 12 105,629,199 (GRCm39) missense probably damaging 1.00
R8222:Atg2b UTSW 12 105,618,475 (GRCm39) missense possibly damaging 0.95
R8469:Atg2b UTSW 12 105,604,170 (GRCm39) missense probably benign 0.00
R8708:Atg2b UTSW 12 105,635,687 (GRCm39) critical splice acceptor site probably benign
R8784:Atg2b UTSW 12 105,605,500 (GRCm39) missense probably damaging 1.00
R8975:Atg2b UTSW 12 105,602,725 (GRCm39) missense probably damaging 1.00
R8988:Atg2b UTSW 12 105,583,388 (GRCm39) missense probably damaging 0.97
R9071:Atg2b UTSW 12 105,625,099 (GRCm39) nonsense probably null
R9269:Atg2b UTSW 12 105,618,359 (GRCm39) missense probably damaging 1.00
R9355:Atg2b UTSW 12 105,636,980 (GRCm39) missense possibly damaging 0.48
R9492:Atg2b UTSW 12 105,624,549 (GRCm39) missense probably benign 0.06
R9709:Atg2b UTSW 12 105,611,140 (GRCm39) missense probably damaging 1.00
R9717:Atg2b UTSW 12 105,605,561 (GRCm39) missense probably benign
R9746:Atg2b UTSW 12 105,630,197 (GRCm39) missense possibly damaging 0.84
X0018:Atg2b UTSW 12 105,632,956 (GRCm39) missense possibly damaging 0.86
X0066:Atg2b UTSW 12 105,613,044 (GRCm39) missense probably benign 0.12
Z1177:Atg2b UTSW 12 105,602,023 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCCTTAACAGATAGGAAATTCACTC -3'
(R):5'- GTCAGAATGAGCATGCCAAGAC -3'

Sequencing Primer
(F):5'- TTCACTCGCCAAACAGAGGAG -3'
(R):5'- TGAGCATGCCAAGACACATTCTTTC -3'
Posted On 2022-05-16