Mutagenetix > Incidental Mutation

Incidental Mutation 'R9402:Pcdh17'

711309

Institutional Source

Beutler Lab

Gene Symbol

Pcdh17

Ensembl Gene

ENSMUSG00000035566

Gene Name

protocadherin 17

Synonyms

C030033F14Rik, LOC219228

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.127) question?

Stock #

R9402 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84443563-84539002 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84447206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 371 (V371A)

Ref Sequence

ENSEMBL: ENSMUSP00000071325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071370]

AlphaFold

E9PXF0

Predicted Effect

probably damaging
Transcript: ENSMUST00000071370
AA Change: V371A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071325
Gene: ENSMUSG00000035566
AA Change: V371A

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
CA	54	131	6.8e-4	SMART
CA	155	242	8.81e-21	SMART
CA	266	350	8.27e-26	SMART
CA	375	468	9.14e-28	SMART
CA	492	579	8.4e-27	SMART
CA	608	687	2.53e-12	SMART
low complexity region	703	725	N/A	INTRINSIC
low complexity region	751	759	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic transmission, increased synaptic vesicle number and decreased depression-related behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	T	G	1: 136,227,610	S86R	probably benign	Het
Abca9	T	A	11: 110,158,328	Q218L	probably benign	Het
Atg2b	A	G	12: 105,648,423	F1083S	probably damaging	Het
Bche	T	C	3: 73,701,323	N257D	probably benign	Het
Cfap221	T	A	1: 119,932,821	M692L	probably benign	Het
Cfap46	G	T	7: 139,635,949	P1530Q	unknown	Het
Crim1	CCGC	CC	17: 78,350,865		probably null	Het
Cyp4f39	T	C	17: 32,491,209		probably null	Het
Daam1	A	G	12: 71,959,830	T674A	probably benign	Het
Elp2	A	T	18: 24,626,163	I526L	probably benign	Het
Exoc4	T	A	6: 33,476,143	*523K	probably null	Het
Fbxl7	G	A	15: 26,552,503	S226L	probably damaging	Het
Fry	G	A	5: 150,433,696	E1903K	possibly damaging	Het
Fry	G	A	5: 150,436,853	R1988K	probably damaging	Het
Gas1	A	T	13: 60,176,202	M206K	probably damaging	Het
Gbp10	T	A	5: 105,233,997	T96S	possibly damaging	Het
Gm14569	G	A	X: 36,430,896	P1387S	probably damaging	Het
Gpaa1	A	G	15: 76,332,218	T105A	probably benign	Het
Hoxc13	C	A	15: 102,921,616	C143*	probably null	Het
Htt	T	C	5: 34,848,980	I1411T	probably damaging	Het
Jmy	C	T	13: 93,499,170	C46Y	probably damaging	Het
Klhl40	A	G	9: 121,780,416	Y453C	possibly damaging	Het
Krit1	T	A	5: 3,822,210	Y460N	possibly damaging	Het
Lamb3	C	A	1: 193,331,396	T526K		Het
Lrrc29	T	A	8: 105,323,356	Y12F	probably benign	Het
Luzp1	T	A	4: 136,543,182	H905Q	probably damaging	Het
Lyst	T	A	13: 13,637,878	H958Q	probably benign	Het
Magi1	T	C	6: 94,283,297	N9S	probably benign	Het
Mmadhc	A	T	2: 50,281,107	V231E	probably benign	Het
Muc5b	T	A	7: 141,845,414	M364K	unknown	Het
Nae1	A	G	8: 104,528,185		probably null	Het
Ndst4	C	T	3: 125,724,736	S354L	probably benign	Het
Nlgn2	A	G	11: 69,828,107	F252S		Het
Nlrp9a	A	T	7: 26,570,605	N874I	possibly damaging	Het
Nodal	T	C	10: 61,423,600	I272T	probably damaging	Het
Olfr1234	C	A	2: 89,362,779	G217*	probably null	Het
Olfr1259	A	T	2: 89,943,940	Y58*	probably null	Het
Olfr599	T	C	7: 103,338,989	S312P	probably benign	Het
Olfr645	G	A	7: 104,084,403	R226*	probably null	Het
Orm1	C	A	4: 63,345,132	Q61K	possibly damaging	Het
Pcdhb19	C	T	18: 37,499,479	Q776*	probably null	Het
Phf14	A	G	6: 11,933,780	R214G	possibly damaging	Het
Phf3	G	A	1: 30,811,847	T1142M	probably damaging	Het
Pigz	A	G	16: 31,945,369	E415G	probably damaging	Het
Pramel5	T	C	4: 144,271,456	T406A	probably benign	Het
Prtg	A	G	9: 72,911,971	E1082G	probably benign	Het
Rtp3	A	G	9: 110,985,963	C445R	unknown	Het
Scn3b	A	T	9: 40,282,556	E193V	probably damaging	Het
Scn7a	A	T	2: 66,680,112	N1315K	probably damaging	Het
Snx14	C	T	9: 88,407,437	G254D	probably damaging	Het
Srbd1	T	C	17: 86,099,277	D560G	probably benign	Het
Srp72	T	A	5: 76,976,482	L65*	probably null	Het
Steap1	T	A	5: 5,740,664	I95F		Het
Taf3	A	G	2: 9,951,112		probably null	Het
Taok2	T	C	7: 126,870,228	N1143D		Het
Tas2r114	C	T	6: 131,689,931	G45S	possibly damaging	Het
Tcerg1l	T	C	7: 138,209,822	K548E	probably damaging	Het
Tcp1	T	A	17: 12,922,618	L328Q	probably benign	Het
Tns2	A	G	15: 102,113,188	H1096R	probably damaging	Het
Trps1	A	T	15: 50,846,256	Y233N	probably damaging	Het
Tubgcp6	A	G	15: 89,102,861	V1303A	probably benign	Het
Ugt1a2	T	C	1: 88,200,962	F109S	possibly damaging	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Zfp748	A	G	13: 67,545,392	V54A	probably benign	Het

Other mutations in Pcdh17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Pcdh17	APN	14	84447544	missense	probably damaging	1.00
IGL00902:Pcdh17	APN	14	84446849	missense	probably damaging	1.00
IGL01596:Pcdh17	APN	14	84448192	missense	probably damaging	1.00
IGL01665:Pcdh17	APN	14	84447002	missense	probably damaging	0.99
IGL01944:Pcdh17	APN	14	84447520	missense	probably benign	0.01
IGL01944:Pcdh17	APN	14	84447521	missense	probably damaging	0.98
IGL01977:Pcdh17	APN	14	84533097	missense	possibly damaging	0.49
IGL01988:Pcdh17	APN	14	84446622	missense	probably damaging	1.00
IGL02168:Pcdh17	APN	14	84533195	missense	probably benign	0.19
IGL02500:Pcdh17	APN	14	84533469	missense	probably benign	0.17
IGL02874:Pcdh17	APN	14	84448240	missense	possibly damaging	0.71
IGL02882:Pcdh17	APN	14	84446661	missense	probably damaging	0.98
IGL02941:Pcdh17	APN	14	84448307	missense	probably damaging	1.00
IGL03328:Pcdh17	APN	14	84533111	missense	probably benign
R0226_Pcdh17_958	UTSW	14	84448201	missense	probably damaging	0.99
R3405_Pcdh17_345	UTSW	14	84446622	missense	probably damaging	1.00
PIT4151001:Pcdh17	UTSW	14	84447358	missense	probably benign	0.05
R0226:Pcdh17	UTSW	14	84448201	missense	probably damaging	0.99
R0537:Pcdh17	UTSW	14	84447457	missense	probably damaging	1.00
R0647:Pcdh17	UTSW	14	84447773	missense	possibly damaging	0.58
R0939:Pcdh17	UTSW	14	84447755	missense	probably damaging	1.00
R1014:Pcdh17	UTSW	14	84447488	missense	probably damaging	1.00
R1753:Pcdh17	UTSW	14	84477654	missense	probably benign	0.17
R3404:Pcdh17	UTSW	14	84446622	missense	probably damaging	1.00
R3405:Pcdh17	UTSW	14	84446622	missense	probably damaging	1.00
R3406:Pcdh17	UTSW	14	84446622	missense	probably damaging	1.00
R3746:Pcdh17	UTSW	14	84533037	missense	probably benign	0.02
R3852:Pcdh17	UTSW	14	84447259	nonsense	probably null
R4015:Pcdh17	UTSW	14	84447107	missense	probably damaging	0.99
R4348:Pcdh17	UTSW	14	84447620	missense	probably damaging	0.97
R4365:Pcdh17	UTSW	14	84448286	missense	probably damaging	0.97
R4375:Pcdh17	UTSW	14	84448271	missense	possibly damaging	0.80
R4693:Pcdh17	UTSW	14	84533520	missense	probably damaging	1.00
R4811:Pcdh17	UTSW	14	84447935	missense	probably damaging	1.00
R5007:Pcdh17	UTSW	14	84533297	missense	probably benign
R5074:Pcdh17	UTSW	14	84533342	missense	probably benign
R5080:Pcdh17	UTSW	14	84533310	missense	probably benign	0.01
R5138:Pcdh17	UTSW	14	84447209	missense	probably damaging	1.00
R5330:Pcdh17	UTSW	14	84533046	missense	probably damaging	1.00
R5541:Pcdh17	UTSW	14	84447416	missense	probably damaging	0.97
R5686:Pcdh17	UTSW	14	84532993	missense	probably damaging	1.00
R5692:Pcdh17	UTSW	14	84448540	missense	probably benign	0.22
R5695:Pcdh17	UTSW	14	84446360	missense	probably damaging	1.00
R5949:Pcdh17	UTSW	14	84447556	missense	probably damaging	1.00
R6127:Pcdh17	UTSW	14	84533060	missense	probably damaging	0.96
R6294:Pcdh17	UTSW	14	84477668	missense	probably benign	0.01
R6508:Pcdh17	UTSW	14	84447979	missense	probably damaging	1.00
R6726:Pcdh17	UTSW	14	84446217	missense	probably damaging	1.00
R7094:Pcdh17	UTSW	14	84447395	missense	probably damaging	1.00
R7137:Pcdh17	UTSW	14	84533549	missense	possibly damaging	0.65
R7828:Pcdh17	UTSW	14	84532985	missense	probably damaging	0.99
R7904:Pcdh17	UTSW	14	84448484	missense	possibly damaging	0.94
R8507:Pcdh17	UTSW	14	84445944	start gained	probably benign
R9069:Pcdh17	UTSW	14	84447644	missense	possibly damaging	0.58
R9239:Pcdh17	UTSW	14	84533209	missense	probably benign	0.45
R9283:Pcdh17	UTSW	14	84448153	missense	possibly damaging	0.78
R9382:Pcdh17	UTSW	14	84448082	missense	probably damaging	1.00
R9459:Pcdh17	UTSW	14	84448623	missense	probably benign	0.00
R9548:Pcdh17	UTSW	14	84447962	missense	possibly damaging	0.67
R9560:Pcdh17	UTSW	14	84533458	missense	probably benign	0.00
R9777:Pcdh17	UTSW	14	84446243	missense	probably benign	0.00
R9792:Pcdh17	UTSW	14	84532910	nonsense	probably null
R9793:Pcdh17	UTSW	14	84532910	nonsense	probably null
R9794:Pcdh17	UTSW	14	84532910	nonsense	probably null
R9795:Pcdh17	UTSW	14	84532910	nonsense	probably null
X0025:Pcdh17	UTSW	14	84446562	missense	possibly damaging	0.86
X0026:Pcdh17	UTSW	14	84533097	missense	possibly damaging	0.49
X0027:Pcdh17	UTSW	14	84448310	missense	possibly damaging	0.80
Z1088:Pcdh17	UTSW	14	84448274	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- ATCCTAAAACTGGCCTGATCCG -3'
(R):5'- TTGTGTCTCACGGTCCAGTG -3'

Sequencing Primer
(F):5'- TGATCCGCGTTAAGGGCAAC -3'
(R):5'- GTCCAGTGGACGGTCAGTC -3'

Posted On

2022-05-16