Incidental Mutation 'R9402:Trps1'
ID 711311
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Name transcriptional repressor GATA binding 1
Synonyms D15Ertd586e
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9402 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 50654752-50890463 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 50846256 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 233 (Y233N)
Ref Sequence ENSEMBL: ENSMUSP00000139017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885] [ENSMUST00000185183]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000077935
AA Change: Y229N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: Y229N

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165201
AA Change: Y229N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: Y229N

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183757
AA Change: Y233N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: Y233N

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183997
AA Change: Y233N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: Y233N

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184458
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184885
AA Change: Y183N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: Y183N

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185183
AA Change: Y229N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138967
Gene: ENSMUSG00000038679
AA Change: Y229N

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T G 1: 136,227,610 S86R probably benign Het
Abca9 T A 11: 110,158,328 Q218L probably benign Het
Atg2b A G 12: 105,648,423 F1083S probably damaging Het
Bche T C 3: 73,701,323 N257D probably benign Het
Cfap221 T A 1: 119,932,821 M692L probably benign Het
Cfap46 G T 7: 139,635,949 P1530Q unknown Het
Crim1 CCGC CC 17: 78,350,865 probably null Het
Cyp4f39 T C 17: 32,491,209 probably null Het
Daam1 A G 12: 71,959,830 T674A probably benign Het
Elp2 A T 18: 24,626,163 I526L probably benign Het
Exoc4 T A 6: 33,476,143 *523K probably null Het
Fbxl7 G A 15: 26,552,503 S226L probably damaging Het
Fry G A 5: 150,433,696 E1903K possibly damaging Het
Fry G A 5: 150,436,853 R1988K probably damaging Het
Gas1 A T 13: 60,176,202 M206K probably damaging Het
Gbp10 T A 5: 105,233,997 T96S possibly damaging Het
Gm14569 G A X: 36,430,896 P1387S probably damaging Het
Gpaa1 A G 15: 76,332,218 T105A probably benign Het
Hoxc13 C A 15: 102,921,616 C143* probably null Het
Htt T C 5: 34,848,980 I1411T probably damaging Het
Jmy C T 13: 93,499,170 C46Y probably damaging Het
Klhl40 A G 9: 121,780,416 Y453C possibly damaging Het
Krit1 T A 5: 3,822,210 Y460N possibly damaging Het
Lamb3 C A 1: 193,331,396 T526K Het
Lrrc29 T A 8: 105,323,356 Y12F probably benign Het
Luzp1 T A 4: 136,543,182 H905Q probably damaging Het
Lyst T A 13: 13,637,878 H958Q probably benign Het
Magi1 T C 6: 94,283,297 N9S probably benign Het
Mmadhc A T 2: 50,281,107 V231E probably benign Het
Muc5b T A 7: 141,845,414 M364K unknown Het
Nae1 A G 8: 104,528,185 probably null Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Nlgn2 A G 11: 69,828,107 F252S Het
Nlrp9a A T 7: 26,570,605 N874I possibly damaging Het
Nodal T C 10: 61,423,600 I272T probably damaging Het
Olfr1234 C A 2: 89,362,779 G217* probably null Het
Olfr1259 A T 2: 89,943,940 Y58* probably null Het
Olfr599 T C 7: 103,338,989 S312P probably benign Het
Olfr645 G A 7: 104,084,403 R226* probably null Het
Orm1 C A 4: 63,345,132 Q61K possibly damaging Het
Pcdh17 T C 14: 84,447,206 V371A probably damaging Het
Pcdhb19 C T 18: 37,499,479 Q776* probably null Het
Phf14 A G 6: 11,933,780 R214G possibly damaging Het
Phf3 G A 1: 30,811,847 T1142M probably damaging Het
Pigz A G 16: 31,945,369 E415G probably damaging Het
Pramel5 T C 4: 144,271,456 T406A probably benign Het
Prtg A G 9: 72,911,971 E1082G probably benign Het
Rtp3 A G 9: 110,985,963 C445R unknown Het
Scn3b A T 9: 40,282,556 E193V probably damaging Het
Scn7a A T 2: 66,680,112 N1315K probably damaging Het
Snx14 C T 9: 88,407,437 G254D probably damaging Het
Srbd1 T C 17: 86,099,277 D560G probably benign Het
Srp72 T A 5: 76,976,482 L65* probably null Het
Steap1 T A 5: 5,740,664 I95F Het
Taf3 A G 2: 9,951,112 probably null Het
Taok2 T C 7: 126,870,228 N1143D Het
Tas2r114 C T 6: 131,689,931 G45S possibly damaging Het
Tcerg1l T C 7: 138,209,822 K548E probably damaging Het
Tcp1 T A 17: 12,922,618 L328Q probably benign Het
Tns2 A G 15: 102,113,188 H1096R probably damaging Het
Tubgcp6 A G 15: 89,102,861 V1303A probably benign Het
Ugt1a2 T C 1: 88,200,962 F109S possibly damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Zfp748 A G 13: 67,545,392 V54A probably benign Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50846870 missense probably benign 0.07
IGL00497:Trps1 APN 15 50661307 missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50661085 missense probably damaging 1.00
IGL01325:Trps1 APN 15 50846814 missense probably benign 0.40
IGL02132:Trps1 APN 15 50822278 missense probably damaging 1.00
IGL02631:Trps1 APN 15 50846021 missense probably damaging 1.00
IGL02740:Trps1 APN 15 50846539 missense probably damaging 1.00
IGL02821:Trps1 APN 15 50660877 missense probably damaging 1.00
IGL03096:Trps1 APN 15 50846479 missense probably benign
F5770:Trps1 UTSW 15 50831577 missense probably damaging 1.00
R0050:Trps1 UTSW 15 50765525 missense probably benign 0.18
R0244:Trps1 UTSW 15 50664743 missense probably damaging 1.00
R0377:Trps1 UTSW 15 50831778 nonsense probably null
R0599:Trps1 UTSW 15 50831860 nonsense probably null
R0848:Trps1 UTSW 15 50661549 missense possibly damaging 0.54
R1744:Trps1 UTSW 15 50661213 missense probably damaging 1.00
R1830:Trps1 UTSW 15 50661136 missense probably damaging 0.99
R2083:Trps1 UTSW 15 50822305 missense probably damaging 1.00
R2167:Trps1 UTSW 15 50831730 missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50822398 missense probably damaging 1.00
R2314:Trps1 UTSW 15 50661346 missense probably damaging 1.00
R3735:Trps1 UTSW 15 50846060 missense possibly damaging 0.94
R4133:Trps1 UTSW 15 50831387 missense probably damaging 1.00
R4223:Trps1 UTSW 15 50846648 missense probably benign
R4280:Trps1 UTSW 15 50846082 missense probably benign 0.00
R4566:Trps1 UTSW 15 50831678 missense probably damaging 1.00
R4810:Trps1 UTSW 15 50822296 missense probably benign 0.14
R4828:Trps1 UTSW 15 50660677 makesense probably null
R4838:Trps1 UTSW 15 50827316 missense probably benign 0.05
R4852:Trps1 UTSW 15 50846309 missense probably damaging 1.00
R5001:Trps1 UTSW 15 50661307 missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50664760 missense probably damaging 1.00
R5463:Trps1 UTSW 15 50831890 nonsense probably null
R5677:Trps1 UTSW 15 50846108 missense probably damaging 1.00
R5691:Trps1 UTSW 15 50827304 missense probably benign
R6432:Trps1 UTSW 15 50831397 missense probably damaging 0.96
R6528:Trps1 UTSW 15 50822427 missense probably benign 0.01
R6594:Trps1 UTSW 15 50830955 missense probably damaging 0.99
R6827:Trps1 UTSW 15 50822563 missense probably benign 0.14
R6862:Trps1 UTSW 15 50831605 critical splice donor site probably null
R6912:Trps1 UTSW 15 50822298 missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50822397 missense possibly damaging 0.95
R7846:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7857:Trps1 UTSW 15 50661005 missense probably damaging 1.00
R7986:Trps1 UTSW 15 50661736 missense probably damaging 1.00
R7986:Trps1 UTSW 15 50889623 missense probably benign 0.00
R8744:Trps1 UTSW 15 50661246 missense probably damaging 1.00
R8838:Trps1 UTSW 15 50889611 missense probably benign 0.01
R8859:Trps1 UTSW 15 50822373 missense possibly damaging 0.77
R8935:Trps1 UTSW 15 50888948 nonsense probably null
R9044:Trps1 UTSW 15 50822607 missense probably benign 0.11
R9142:Trps1 UTSW 15 50661262 missense probably damaging 0.98
R9211:Trps1 UTSW 15 50831444 missense probably damaging 1.00
R9283:Trps1 UTSW 15 50831051 missense probably damaging 1.00
R9363:Trps1 UTSW 15 50661280 missense probably damaging 1.00
R9562:Trps1 UTSW 15 50661261 missense probably damaging 1.00
R9647:Trps1 UTSW 15 50661548 missense probably benign 0.09
R9803:Trps1 UTSW 15 50846694 missense possibly damaging 0.94
V7580:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7581:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7583:Trps1 UTSW 15 50831577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTTAGTAAAGCAGGCCGTG -3'
(R):5'- CAAGCCAATTGTCAAGGTTTGAG -3'

Sequencing Primer
(F):5'- CGTGAAGAGCTGATATCCTGC -3'
(R):5'- CCAATTGTCAAGGTTTGAGTCCAG -3'
Posted On 2022-05-16