Incidental Mutation 'R9402:Trps1'
ID 711311
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Name transcriptional repressor GATA binding 1
Synonyms D15Ertd586e, trichorhinophalangeal syndrome I (human)
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9402 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 50518148-50753859 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 50709652 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 233 (Y233N)
Ref Sequence ENSEMBL: ENSMUSP00000139017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885] [ENSMUST00000185183]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000077935
AA Change: Y229N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: Y229N

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165201
AA Change: Y229N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: Y229N

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183757
AA Change: Y233N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: Y233N

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183997
AA Change: Y233N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: Y233N

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184458
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184885
AA Change: Y183N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: Y183N

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185183
AA Change: Y229N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138967
Gene: ENSMUSG00000038679
AA Change: Y229N

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,049,154 (GRCm39) Q218L probably benign Het
Atg2b A G 12: 105,614,682 (GRCm39) F1083S probably damaging Het
Bche T C 3: 73,608,656 (GRCm39) N257D probably benign Het
Cfap221 T A 1: 119,860,551 (GRCm39) M692L probably benign Het
Cfap46 G T 7: 139,215,865 (GRCm39) P1530Q unknown Het
Crim1 CCGC CC 17: 78,658,294 (GRCm39) probably null Het
Cyp4f39 T C 17: 32,710,183 (GRCm39) probably null Het
Daam1 A G 12: 72,006,604 (GRCm39) T674A probably benign Het
Elp2 A T 18: 24,759,220 (GRCm39) I526L probably benign Het
Exoc4 T A 6: 33,453,078 (GRCm39) *523K probably null Het
Fbxl7 G A 15: 26,552,589 (GRCm39) S226L probably damaging Het
Fbxl9 T A 8: 106,049,988 (GRCm39) Y12F probably benign Het
Fry G A 5: 150,357,161 (GRCm39) E1903K possibly damaging Het
Fry G A 5: 150,360,318 (GRCm39) R1988K probably damaging Het
Gas1 A T 13: 60,324,016 (GRCm39) M206K probably damaging Het
Gbp10 T A 5: 105,381,863 (GRCm39) T96S possibly damaging Het
Gm14569 G A X: 35,694,549 (GRCm39) P1387S probably damaging Het
Gpaa1 A G 15: 76,216,418 (GRCm39) T105A probably benign Het
Hoxc13 C A 15: 102,830,051 (GRCm39) C143* probably null Het
Htt T C 5: 35,006,324 (GRCm39) I1411T probably damaging Het
Inava T G 1: 136,155,348 (GRCm39) S86R probably benign Het
Jmy C T 13: 93,635,678 (GRCm39) C46Y probably damaging Het
Klhl40 A G 9: 121,609,482 (GRCm39) Y453C possibly damaging Het
Krit1 T A 5: 3,872,210 (GRCm39) Y460N possibly damaging Het
Lamb3 C A 1: 193,013,704 (GRCm39) T526K Het
Luzp1 T A 4: 136,270,493 (GRCm39) H905Q probably damaging Het
Lyst T A 13: 13,812,463 (GRCm39) H958Q probably benign Het
Magi1 T C 6: 94,260,278 (GRCm39) N9S probably benign Het
Mmadhc A T 2: 50,171,119 (GRCm39) V231E probably benign Het
Muc5b T A 7: 141,399,151 (GRCm39) M364K unknown Het
Nae1 A G 8: 105,254,817 (GRCm39) probably null Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Nlgn2 A G 11: 69,718,933 (GRCm39) F252S Het
Nlrp9a A T 7: 26,270,030 (GRCm39) N874I possibly damaging Het
Nodal T C 10: 61,259,379 (GRCm39) I272T probably damaging Het
Or4a15 C A 2: 89,193,123 (GRCm39) G217* probably null Het
Or4c12 A T 2: 89,774,284 (GRCm39) Y58* probably null Het
Or51a24 G A 7: 103,733,610 (GRCm39) R226* probably null Het
Or52ab4 T C 7: 102,988,196 (GRCm39) S312P probably benign Het
Orm1 C A 4: 63,263,369 (GRCm39) Q61K possibly damaging Het
Pcdh17 T C 14: 84,684,646 (GRCm39) V371A probably damaging Het
Pcdhb19 C T 18: 37,632,532 (GRCm39) Q776* probably null Het
Phf14 A G 6: 11,933,779 (GRCm39) R214G possibly damaging Het
Phf3 G A 1: 30,850,928 (GRCm39) T1142M probably damaging Het
Pigz A G 16: 31,764,187 (GRCm39) E415G probably damaging Het
Pramel5 T C 4: 143,998,026 (GRCm39) T406A probably benign Het
Prtg A G 9: 72,819,253 (GRCm39) E1082G probably benign Het
Rtp3 A G 9: 110,815,031 (GRCm39) C445R unknown Het
Scn3b A T 9: 40,193,852 (GRCm39) E193V probably damaging Het
Scn7a A T 2: 66,510,456 (GRCm39) N1315K probably damaging Het
Snx14 C T 9: 88,289,490 (GRCm39) G254D probably damaging Het
Srbd1 T C 17: 86,406,705 (GRCm39) D560G probably benign Het
Srp72 T A 5: 77,124,329 (GRCm39) L65* probably null Het
Steap1 T A 5: 5,790,664 (GRCm39) I95F Het
Taf3 A G 2: 9,955,923 (GRCm39) probably null Het
Taok2 T C 7: 126,469,400 (GRCm39) N1143D Het
Tas2r114 C T 6: 131,666,894 (GRCm39) G45S possibly damaging Het
Tcerg1l T C 7: 137,811,551 (GRCm39) K548E probably damaging Het
Tcp1 T A 17: 13,141,505 (GRCm39) L328Q probably benign Het
Tns2 A G 15: 102,021,623 (GRCm39) H1096R probably damaging Het
Tubgcp6 A G 15: 88,987,064 (GRCm39) V1303A probably benign Het
Ugt1a2 T C 1: 88,128,684 (GRCm39) F109S possibly damaging Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Zfp748 A G 13: 67,693,511 (GRCm39) V54A probably benign Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50,710,266 (GRCm39) missense probably benign 0.07
IGL00497:Trps1 APN 15 50,524,703 (GRCm39) missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50,524,481 (GRCm39) missense probably damaging 1.00
IGL01325:Trps1 APN 15 50,710,210 (GRCm39) missense probably benign 0.40
IGL02132:Trps1 APN 15 50,685,674 (GRCm39) missense probably damaging 1.00
IGL02631:Trps1 APN 15 50,709,417 (GRCm39) missense probably damaging 1.00
IGL02740:Trps1 APN 15 50,709,935 (GRCm39) missense probably damaging 1.00
IGL02821:Trps1 APN 15 50,524,273 (GRCm39) missense probably damaging 1.00
IGL03096:Trps1 APN 15 50,709,875 (GRCm39) missense probably benign
F5770:Trps1 UTSW 15 50,694,973 (GRCm39) missense probably damaging 1.00
R0050:Trps1 UTSW 15 50,628,921 (GRCm39) missense probably benign 0.18
R0244:Trps1 UTSW 15 50,528,139 (GRCm39) missense probably damaging 1.00
R0377:Trps1 UTSW 15 50,695,174 (GRCm39) nonsense probably null
R0599:Trps1 UTSW 15 50,695,256 (GRCm39) nonsense probably null
R0848:Trps1 UTSW 15 50,524,945 (GRCm39) missense possibly damaging 0.54
R1744:Trps1 UTSW 15 50,524,609 (GRCm39) missense probably damaging 1.00
R1830:Trps1 UTSW 15 50,524,532 (GRCm39) missense probably damaging 0.99
R2083:Trps1 UTSW 15 50,685,701 (GRCm39) missense probably damaging 1.00
R2167:Trps1 UTSW 15 50,695,126 (GRCm39) missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50,685,794 (GRCm39) missense probably damaging 1.00
R2314:Trps1 UTSW 15 50,524,742 (GRCm39) missense probably damaging 1.00
R3735:Trps1 UTSW 15 50,709,456 (GRCm39) missense possibly damaging 0.94
R4133:Trps1 UTSW 15 50,694,783 (GRCm39) missense probably damaging 1.00
R4223:Trps1 UTSW 15 50,710,044 (GRCm39) missense probably benign
R4280:Trps1 UTSW 15 50,709,478 (GRCm39) missense probably benign 0.00
R4566:Trps1 UTSW 15 50,695,074 (GRCm39) missense probably damaging 1.00
R4810:Trps1 UTSW 15 50,685,692 (GRCm39) missense probably benign 0.14
R4828:Trps1 UTSW 15 50,524,073 (GRCm39) makesense probably null
R4838:Trps1 UTSW 15 50,690,712 (GRCm39) missense probably benign 0.05
R4852:Trps1 UTSW 15 50,709,705 (GRCm39) missense probably damaging 1.00
R5001:Trps1 UTSW 15 50,524,703 (GRCm39) missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50,528,156 (GRCm39) missense probably damaging 1.00
R5463:Trps1 UTSW 15 50,695,286 (GRCm39) nonsense probably null
R5677:Trps1 UTSW 15 50,709,504 (GRCm39) missense probably damaging 1.00
R5691:Trps1 UTSW 15 50,690,700 (GRCm39) missense probably benign
R6432:Trps1 UTSW 15 50,694,793 (GRCm39) missense probably damaging 0.96
R6528:Trps1 UTSW 15 50,685,823 (GRCm39) missense probably benign 0.01
R6594:Trps1 UTSW 15 50,694,351 (GRCm39) missense probably damaging 0.99
R6827:Trps1 UTSW 15 50,685,959 (GRCm39) missense probably benign 0.14
R6862:Trps1 UTSW 15 50,695,001 (GRCm39) critical splice donor site probably null
R6912:Trps1 UTSW 15 50,685,694 (GRCm39) missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50,685,793 (GRCm39) missense possibly damaging 0.95
R7846:Trps1 UTSW 15 50,695,273 (GRCm39) missense probably damaging 0.99
R7857:Trps1 UTSW 15 50,524,401 (GRCm39) missense probably damaging 1.00
R7986:Trps1 UTSW 15 50,753,019 (GRCm39) missense probably benign 0.00
R7986:Trps1 UTSW 15 50,525,132 (GRCm39) missense probably damaging 1.00
R8744:Trps1 UTSW 15 50,524,642 (GRCm39) missense probably damaging 1.00
R8838:Trps1 UTSW 15 50,753,007 (GRCm39) missense probably benign 0.01
R8859:Trps1 UTSW 15 50,685,769 (GRCm39) missense possibly damaging 0.77
R8935:Trps1 UTSW 15 50,752,344 (GRCm39) nonsense probably null
R9044:Trps1 UTSW 15 50,686,003 (GRCm39) missense probably benign 0.11
R9142:Trps1 UTSW 15 50,524,658 (GRCm39) missense probably damaging 0.98
R9211:Trps1 UTSW 15 50,694,840 (GRCm39) missense probably damaging 1.00
R9283:Trps1 UTSW 15 50,694,447 (GRCm39) missense probably damaging 1.00
R9363:Trps1 UTSW 15 50,524,676 (GRCm39) missense probably damaging 1.00
R9562:Trps1 UTSW 15 50,524,657 (GRCm39) missense probably damaging 1.00
R9647:Trps1 UTSW 15 50,524,944 (GRCm39) missense probably benign 0.09
R9803:Trps1 UTSW 15 50,710,090 (GRCm39) missense possibly damaging 0.94
V7580:Trps1 UTSW 15 50,694,973 (GRCm39) missense probably damaging 1.00
V7581:Trps1 UTSW 15 50,694,973 (GRCm39) missense probably damaging 1.00
V7583:Trps1 UTSW 15 50,694,973 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTTAGTAAAGCAGGCCGTG -3'
(R):5'- CAAGCCAATTGTCAAGGTTTGAG -3'

Sequencing Primer
(F):5'- CGTGAAGAGCTGATATCCTGC -3'
(R):5'- CCAATTGTCAAGGTTTGAGTCCAG -3'
Posted On 2022-05-16