Incidental Mutation 'R9402:Crim1'
ID 711319
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Name cysteine rich transmembrane BMP regulator 1 (chordin like)
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9402 (G1)
Quality Score 217.468
Status Not validated
Chromosome 17
Chromosomal Location 78200248-78376592 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CCGC to CC at 78350865 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112498]
AlphaFold Q9JLL0
Predicted Effect probably null
Transcript: ENSMUST00000112498
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T G 1: 136,227,610 S86R probably benign Het
Abca9 T A 11: 110,158,328 Q218L probably benign Het
Atg2b A G 12: 105,648,423 F1083S probably damaging Het
Bche T C 3: 73,701,323 N257D probably benign Het
Cfap221 T A 1: 119,932,821 M692L probably benign Het
Cfap46 G T 7: 139,635,949 P1530Q unknown Het
Cyp4f39 T C 17: 32,491,209 probably null Het
Daam1 A G 12: 71,959,830 T674A probably benign Het
Elp2 A T 18: 24,626,163 I526L probably benign Het
Exoc4 T A 6: 33,476,143 *523K probably null Het
Fbxl7 G A 15: 26,552,503 S226L probably damaging Het
Fry G A 5: 150,433,696 E1903K possibly damaging Het
Fry G A 5: 150,436,853 R1988K probably damaging Het
Gas1 A T 13: 60,176,202 M206K probably damaging Het
Gbp10 T A 5: 105,233,997 T96S possibly damaging Het
Gm14569 G A X: 36,430,896 P1387S probably damaging Het
Gpaa1 A G 15: 76,332,218 T105A probably benign Het
Hoxc13 C A 15: 102,921,616 C143* probably null Het
Htt T C 5: 34,848,980 I1411T probably damaging Het
Jmy C T 13: 93,499,170 C46Y probably damaging Het
Klhl40 A G 9: 121,780,416 Y453C possibly damaging Het
Krit1 T A 5: 3,822,210 Y460N possibly damaging Het
Lamb3 C A 1: 193,331,396 T526K Het
Lrrc29 T A 8: 105,323,356 Y12F probably benign Het
Luzp1 T A 4: 136,543,182 H905Q probably damaging Het
Lyst T A 13: 13,637,878 H958Q probably benign Het
Magi1 T C 6: 94,283,297 N9S probably benign Het
Mmadhc A T 2: 50,281,107 V231E probably benign Het
Muc5b T A 7: 141,845,414 M364K unknown Het
Nae1 A G 8: 104,528,185 probably null Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Nlgn2 A G 11: 69,828,107 F252S Het
Nlrp9a A T 7: 26,570,605 N874I possibly damaging Het
Nodal T C 10: 61,423,600 I272T probably damaging Het
Olfr1234 C A 2: 89,362,779 G217* probably null Het
Olfr1259 A T 2: 89,943,940 Y58* probably null Het
Olfr599 T C 7: 103,338,989 S312P probably benign Het
Olfr645 G A 7: 104,084,403 R226* probably null Het
Orm1 C A 4: 63,345,132 Q61K possibly damaging Het
Pcdh17 T C 14: 84,447,206 V371A probably damaging Het
Pcdhb19 C T 18: 37,499,479 Q776* probably null Het
Phf14 A G 6: 11,933,780 R214G possibly damaging Het
Phf3 G A 1: 30,811,847 T1142M probably damaging Het
Pigz A G 16: 31,945,369 E415G probably damaging Het
Pramel5 T C 4: 144,271,456 T406A probably benign Het
Prtg A G 9: 72,911,971 E1082G probably benign Het
Rtp3 A G 9: 110,985,963 C445R unknown Het
Scn3b A T 9: 40,282,556 E193V probably damaging Het
Scn7a A T 2: 66,680,112 N1315K probably damaging Het
Snx14 C T 9: 88,407,437 G254D probably damaging Het
Srbd1 T C 17: 86,099,277 D560G probably benign Het
Srp72 T A 5: 76,976,482 L65* probably null Het
Steap1 T A 5: 5,740,664 I95F Het
Taf3 A G 2: 9,951,112 probably null Het
Taok2 T C 7: 126,870,228 N1143D Het
Tas2r114 C T 6: 131,689,931 G45S possibly damaging Het
Tcerg1l T C 7: 138,209,822 K548E probably damaging Het
Tcp1 T A 17: 12,922,618 L328Q probably benign Het
Tns2 A G 15: 102,113,188 H1096R probably damaging Het
Trps1 A T 15: 50,846,256 Y233N probably damaging Het
Tubgcp6 A G 15: 89,102,861 V1303A probably benign Het
Ugt1a2 T C 1: 88,200,962 F109S possibly damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Zfp748 A G 13: 67,545,392 V54A probably benign Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78370091 missense probably damaging 1.00
IGL01090:Crim1 APN 17 78347229 missense probably damaging 0.97
IGL01490:Crim1 APN 17 78335296 missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78344434 missense probably benign 0.09
IGL01769:Crim1 APN 17 78313235 missense probably benign 0.02
IGL02004:Crim1 APN 17 78372575 splice site probably benign
IGL02211:Crim1 APN 17 78355145 missense probably damaging 1.00
IGL02275:Crim1 APN 17 78369998 missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78315654 missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78335334 nonsense probably null
IGL02453:Crim1 APN 17 78344484 missense probably damaging 1.00
IGL02481:Crim1 APN 17 78350798 missense probably damaging 0.98
IGL02632:Crim1 APN 17 78372674 missense probably benign 0.08
IGL02652:Crim1 APN 17 78315677 missense probably damaging 1.00
IGL02696:Crim1 APN 17 78279973 missense probably damaging 0.96
IGL02811:Crim1 APN 17 78350701 missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78315750 splice site probably benign
IGL03349:Crim1 APN 17 78355150 nonsense probably null
bugeye UTSW 17 78281347 missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78367798 missense probably benign 0.00
R0227:Crim1 UTSW 17 78344509 splice site probably benign
R0458:Crim1 UTSW 17 78313226 missense probably damaging 0.98
R0482:Crim1 UTSW 17 78372579 missense probably benign 0.00
R0989:Crim1 UTSW 17 78200944 missense probably benign 0.21
R1266:Crim1 UTSW 17 78200833 small deletion probably benign
R1529:Crim1 UTSW 17 78367954 missense probably benign
R1679:Crim1 UTSW 17 78200799 missense probably benign 0.27
R1909:Crim1 UTSW 17 78313127 missense probably benign 0.26
R2273:Crim1 UTSW 17 78355179 critical splice donor site probably null
R3899:Crim1 UTSW 17 78281354 missense probably benign 0.00
R3909:Crim1 UTSW 17 78281239 splice site probably benign
R4092:Crim1 UTSW 17 78350836 missense probably damaging 1.00
R4154:Crim1 UTSW 17 78237843 missense probably benign 0.01
R4687:Crim1 UTSW 17 78303025 missense probably damaging 1.00
R5022:Crim1 UTSW 17 78280129 missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78281347 missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78374090 missense probably damaging 1.00
R5284:Crim1 UTSW 17 78313266 missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78237807 missense probably damaging 1.00
R5635:Crim1 UTSW 17 78315641 missense probably damaging 1.00
R5686:Crim1 UTSW 17 78374083 missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78315717 missense probably damaging 1.00
R6117:Crim1 UTSW 17 78303088 missense probably damaging 1.00
R6129:Crim1 UTSW 17 78281309 missense probably benign 0.17
R6265:Crim1 UTSW 17 78370085 missense probably benign 0.01
R6812:Crim1 UTSW 17 78315600 missense probably damaging 1.00
R6858:Crim1 UTSW 17 78315627 missense probably damaging 1.00
R7920:Crim1 UTSW 17 78303064 missense probably damaging 1.00
R8022:Crim1 UTSW 17 78315555 missense possibly damaging 0.82
R8434:Crim1 UTSW 17 78347257 missense probably benign 0.00
R8782:Crim1 UTSW 17 78200877 missense probably damaging 1.00
R8961:Crim1 UTSW 17 78372688 missense possibly damaging 0.65
R8971:Crim1 UTSW 17 78345980 missense possibly damaging 0.89
R9245:Crim1 UTSW 17 78344442 missense probably damaging 1.00
R9250:Crim1 UTSW 17 78370042 missense probably benign
R9401:Crim1 UTSW 17 78350865 frame shift probably null
R9644:Crim1 UTSW 17 78280068 missense probably damaging 1.00
R9702:Crim1 UTSW 17 78374087 missense probably damaging 1.00
R9710:Crim1 UTSW 17 78303075 nonsense probably null
X0064:Crim1 UTSW 17 78200833 small deletion probably benign
Z1088:Crim1 UTSW 17 78367835 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GATGACTTTGTAGTGCAGAAGC -3'
(R):5'- CACGCTCGTTGGCTGTATTATG -3'

Sequencing Primer
(F):5'- CTTTGTAGTGCAGAAGCCGGAG -3'
(R):5'- TGGGTGATCACAGGGAATAGACTG -3'
Posted On 2022-05-16