Mutagenetix > Incidental Mutation

Incidental Mutation 'R9403:Vcpip1'

711324

Institutional Source

Beutler Lab

Gene Symbol

Vcpip1

Ensembl Gene

ENSMUSG00000045210

Gene Name

valosin containing protein (p97)/p47 complex interacting protein 1

Synonyms

5730421J18Rik, Vcip135, 5730538E15Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.377) question?

Stock #

R9403 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

9718622-9748382 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9745824 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 778 (I778T)

Ref Sequence

ENSEMBL: ENSMUSP00000051248 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057438]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057438
AA Change: I778T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000051248
Gene: ENSMUSG00000045210
AA Change: I778T

Domain	Start	End	E-Value	Type
low complexity region	4	17	N/A	INTRINSIC
low complexity region	19	36	N/A	INTRINSIC
Pfam:OTU	213	354	3.3e-15	PFAM
low complexity region	754	772	N/A	INTRINSIC
low complexity region	1001	1015	N/A	INTRINSIC
low complexity region	1161	1173	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a deubiquitinating enzyme that interacts with valosin containing protein p97 and plays a role in the assembly of Golgi apparatus during mitosis. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	T	G	6: 96,165,299	T255P	probably benign	Het
4930444G20Rik	C	T	10: 22,067,941	D47N	possibly damaging	Het
Angpt4	C	T	2: 151,938,972	T380M	probably damaging	Het
Apoa5	G	C	9: 46,270,646	R340P	probably damaging	Het
Cyp3a41a	T	A	5: 145,702,198	Y320F	probably damaging	Het
Dmtf1	A	G	5: 9,121,927	L503S	possibly damaging	Het
Dock1	T	C	7: 135,168,396	V1795A	probably benign	Het
Dpys	C	G	15: 39,828,071	W285S	probably damaging	Het
Fam187b	T	C	7: 30,977,090	V8A		Het
Fbn2	T	C	18: 58,066,107	E1363G	probably damaging	Het
Glg1	C	T	8: 111,187,793	R453Q	probably benign	Het
Gm5591	T	A	7: 38,520,148	M434L	probably benign	Het
Gm5591	T	C	7: 38,522,256	T130A	probably damaging	Het
Gpld1	G	A	13: 24,979,729	V502I	probably benign	Het
Inhba	A	G	13: 16,017,381	H29R	probably benign	Het
Itga4	T	A	2: 79,325,660	I990N	possibly damaging	Het
Kcnma1	T	A	14: 23,543,077	I280L	probably benign	Het
Malrd1	T	C	2: 15,614,177	V284A		Het
Maml2	C	T	9: 13,621,673	Q728*	probably null	Het
Mkln1	T	C	6: 31,432,970	L181P	probably damaging	Het
Mms22l	T	C	4: 24,580,204		probably null	Het
Muc16	A	G	9: 18,537,764		probably null	Het
Mylk	C	A	16: 34,875,642	S249*	probably null	Het
Naa35	G	A	13: 59,601,003	A150T	possibly damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Nup205	G	A	6: 35,199,974	R635H	probably benign	Het
Olfr263	T	C	13: 21,133,695	F307L	probably benign	Het
Olfr723	T	C	14: 49,929,449	T32A	probably benign	Het
Padi3	T	C	4: 140,810,532	I26V	probably benign	Het
Polq	T	C	16: 37,061,853	S1460P	probably benign	Het
Ptgdr	A	G	14: 44,853,258	S348P		Het
Qsox1	A	G	1: 155,782,597	S409P	probably damaging	Het
Rergl	T	A	6: 139,494,854	Y99F	possibly damaging	Het
Rptn	C	A	3: 93,395,042	H22N	probably benign	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Sh2b1	GGACCAGCTCAG	GGACCAGCTCAGTCACGGTGACCAGCTCAG	7: 126,467,573		probably null	Het
Sh2b1	ACCAGCTCAGCCACGGGG	ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG	7: 126,467,575		probably benign	Het
Slc2a3	A	C	6: 122,736,610	I214M	probably damaging	Het
Slc5a7	A	T	17: 54,276,641	N540K	probably benign	Het
Slco6c1	A	T	1: 97,062,523	S664R	possibly damaging	Het
Tgm4	C	A	9: 123,052,772	S344R	probably damaging	Het
Trim61	T	A	8: 65,014,576	Q11L	probably damaging	Het
Trpm6	C	A	19: 18,832,652	D1137E	possibly damaging	Het
Txndc2	G	A	17: 65,637,997	T395I	probably damaging	Het
Txndc9	T	C	1: 37,995,778	E15G	probably benign	Het
Zfp383	T	C	7: 29,915,259	F313S	possibly damaging	Het

Other mutations in Vcpip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02341:Vcpip1	APN	1	9724950	missense	possibly damaging	0.75
IGL02888:Vcpip1	APN	1	9724786	missense	probably damaging	0.98
IGL03246:Vcpip1	APN	1	9745957	missense	probably benign	0.00
R0243:Vcpip1	UTSW	1	9747206	nonsense	probably null
R0968:Vcpip1	UTSW	1	9746379	missense	probably damaging	1.00
R1139:Vcpip1	UTSW	1	9746723	missense	probably damaging	0.98
R1230:Vcpip1	UTSW	1	9725224	missense	probably damaging	1.00
R1524:Vcpip1	UTSW	1	9724502	missense	probably damaging	1.00
R1989:Vcpip1	UTSW	1	9745563	missense	probably benign	0.11
R2135:Vcpip1	UTSW	1	9747810	missense	probably benign	0.01
R2299:Vcpip1	UTSW	1	9745719	missense	possibly damaging	0.71
R4692:Vcpip1	UTSW	1	9748074	missense	unknown
R4855:Vcpip1	UTSW	1	9747364	missense	probably damaging	1.00
R4883:Vcpip1	UTSW	1	9747198	missense	probably damaging	1.00
R4891:Vcpip1	UTSW	1	9748062	missense	unknown
R4897:Vcpip1	UTSW	1	9747347	missense	probably damaging	0.97
R5141:Vcpip1	UTSW	1	9748077	missense	unknown
R5465:Vcpip1	UTSW	1	9747147	missense	probably benign	0.16
R5651:Vcpip1	UTSW	1	9747840	missense	probably damaging	0.99
R5664:Vcpip1	UTSW	1	9746379	missense	probably damaging	0.99
R6131:Vcpip1	UTSW	1	9747292	missense	probably damaging	0.99
R6187:Vcpip1	UTSW	1	9724780	missense	probably damaging	1.00
R7042:Vcpip1	UTSW	1	9748153	missense	unknown
R7268:Vcpip1	UTSW	1	9746082	missense	probably damaging	0.99
R7417:Vcpip1	UTSW	1	9746315	missense	probably benign	0.00
R7464:Vcpip1	UTSW	1	9746520	missense	probably damaging	0.99
R8138:Vcpip1	UTSW	1	9748109	small deletion	probably benign
R8350:Vcpip1	UTSW	1	9724606	missense	probably benign
R8450:Vcpip1	UTSW	1	9724606	missense	probably benign
R9310:Vcpip1	UTSW	1	9747702	missense	possibly damaging	0.93
R9359:Vcpip1	UTSW	1	9745824	missense	possibly damaging	0.71
R9404:Vcpip1	UTSW	1	9747631	missense	probably damaging	1.00
R9564:Vcpip1	UTSW	1	9747231	missense	possibly damaging	0.94
R9572:Vcpip1	UTSW	1	9746545	missense	possibly damaging	0.92
R9598:Vcpip1	UTSW	1	9745794	missense	probably benign	0.02
Z1177:Vcpip1	UTSW	1	9747082	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAACTGGCTCCTTTTCCATC -3'
(R):5'- AGAATTGGAGTCGCAGCTAC -3'

Sequencing Primer
(F):5'- CTTTTCCATCCCTGCCTGG -3'
(R):5'- GTCGCAGCTACCAACTAAAATTATTC -3'

Posted On

2022-05-16