Incidental Mutation 'R9403:Vcpip1'
ID 711324
Institutional Source Beutler Lab
Gene Symbol Vcpip1
Ensembl Gene ENSMUSG00000045210
Gene Name valosin containing protein (p97)/p47 complex interacting protein 1
Synonyms 5730538E15Rik, Vcip135, 5730421J18Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.455) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 9788847-9818607 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9816049 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 778 (I778T)
Ref Sequence ENSEMBL: ENSMUSP00000051248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057438]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000057438
AA Change: I778T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051248
Gene: ENSMUSG00000045210
AA Change: I778T

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 19 36 N/A INTRINSIC
Pfam:OTU 213 354 3.3e-15 PFAM
low complexity region 754 772 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a deubiquitinating enzyme that interacts with valosin containing protein p97 and plays a role in the assembly of Golgi apparatus during mitosis. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt4 C T 2: 151,780,892 (GRCm39) T380M probably damaging Het
Apoa5 G C 9: 46,181,944 (GRCm39) R340P probably damaging Het
Cyp3a41a T A 5: 145,639,008 (GRCm39) Y320F probably damaging Het
Dmtf1 A G 5: 9,171,927 (GRCm39) L503S possibly damaging Het
Dock1 T C 7: 134,770,125 (GRCm39) V1795A probably benign Het
Dpys C G 15: 39,691,467 (GRCm39) W285S probably damaging Het
Fam187b T C 7: 30,676,515 (GRCm39) V8A Het
Fbn2 T C 18: 58,199,179 (GRCm39) E1363G probably damaging Het
Glg1 C T 8: 111,914,425 (GRCm39) R453Q probably benign Het
Gm5591 T A 7: 38,219,572 (GRCm39) M434L probably benign Het
Gm5591 T C 7: 38,221,680 (GRCm39) T130A probably damaging Het
Gpld1 G A 13: 25,163,712 (GRCm39) V502I probably benign Het
Inhba A G 13: 16,191,966 (GRCm39) H29R probably benign Het
Itga4 T A 2: 79,156,004 (GRCm39) I990N possibly damaging Het
Kcnma1 T A 14: 23,593,145 (GRCm39) I280L probably benign Het
Malrd1 T C 2: 15,618,988 (GRCm39) V284A Het
Maml2 C T 9: 13,532,969 (GRCm39) Q728* probably null Het
Mkln1 T C 6: 31,409,905 (GRCm39) L181P probably damaging Het
Mms22l T C 4: 24,580,204 (GRCm39) probably null Het
Muc16 A G 9: 18,449,060 (GRCm39) probably null Het
Mylk C A 16: 34,696,012 (GRCm39) S249* probably null Het
Naa35 G A 13: 59,748,817 (GRCm39) A150T possibly damaging Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Nup205 G A 6: 35,176,909 (GRCm39) R635H probably benign Het
Nup50l T G 6: 96,142,280 (GRCm39) T255P probably benign Het
Or2w1 T C 13: 21,317,865 (GRCm39) F307L probably benign Het
Or4l1 T C 14: 50,166,906 (GRCm39) T32A probably benign Het
Padi3 T C 4: 140,537,843 (GRCm39) I26V probably benign Het
Polq T C 16: 36,882,215 (GRCm39) S1460P probably benign Het
Ptgdr A G 14: 45,090,715 (GRCm39) S348P Het
Qsox1 A G 1: 155,658,343 (GRCm39) S409P probably damaging Het
Rergl T A 6: 139,471,852 (GRCm39) Y99F possibly damaging Het
Rptn C A 3: 93,302,349 (GRCm39) H22N probably benign Het
Semp2l2b C T 10: 21,943,840 (GRCm39) D47N possibly damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,066,747 (GRCm39) probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,066,745 (GRCm39) probably null Het
Slc2a3 A C 6: 122,713,569 (GRCm39) I214M probably damaging Het
Slc5a7 A T 17: 54,583,669 (GRCm39) N540K probably benign Het
Slco6c1 A T 1: 96,990,248 (GRCm39) S664R possibly damaging Het
Tgm4 C A 9: 122,881,837 (GRCm39) S344R probably damaging Het
Trim61 T A 8: 65,467,228 (GRCm39) Q11L probably damaging Het
Trpm6 C A 19: 18,810,016 (GRCm39) D1137E possibly damaging Het
Txndc2 G A 17: 65,944,992 (GRCm39) T395I probably damaging Het
Txndc9 T C 1: 38,034,859 (GRCm39) E15G probably benign Het
Zfp383 T C 7: 29,614,684 (GRCm39) F313S possibly damaging Het
Other mutations in Vcpip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02341:Vcpip1 APN 1 9,795,175 (GRCm39) missense possibly damaging 0.75
IGL02888:Vcpip1 APN 1 9,795,011 (GRCm39) missense probably damaging 0.98
IGL03246:Vcpip1 APN 1 9,816,182 (GRCm39) missense probably benign 0.00
R0243:Vcpip1 UTSW 1 9,817,431 (GRCm39) nonsense probably null
R0968:Vcpip1 UTSW 1 9,816,604 (GRCm39) missense probably damaging 1.00
R1139:Vcpip1 UTSW 1 9,816,948 (GRCm39) missense probably damaging 0.98
R1230:Vcpip1 UTSW 1 9,795,449 (GRCm39) missense probably damaging 1.00
R1524:Vcpip1 UTSW 1 9,794,727 (GRCm39) missense probably damaging 1.00
R1989:Vcpip1 UTSW 1 9,815,788 (GRCm39) missense probably benign 0.11
R2135:Vcpip1 UTSW 1 9,818,035 (GRCm39) missense probably benign 0.01
R2299:Vcpip1 UTSW 1 9,815,944 (GRCm39) missense possibly damaging 0.71
R4692:Vcpip1 UTSW 1 9,818,299 (GRCm39) missense unknown
R4855:Vcpip1 UTSW 1 9,817,589 (GRCm39) missense probably damaging 1.00
R4883:Vcpip1 UTSW 1 9,817,423 (GRCm39) missense probably damaging 1.00
R4891:Vcpip1 UTSW 1 9,818,287 (GRCm39) missense unknown
R4897:Vcpip1 UTSW 1 9,817,572 (GRCm39) missense probably damaging 0.97
R5141:Vcpip1 UTSW 1 9,818,302 (GRCm39) missense unknown
R5465:Vcpip1 UTSW 1 9,817,372 (GRCm39) missense probably benign 0.16
R5651:Vcpip1 UTSW 1 9,818,065 (GRCm39) missense probably damaging 0.99
R5664:Vcpip1 UTSW 1 9,816,604 (GRCm39) missense probably damaging 0.99
R6131:Vcpip1 UTSW 1 9,817,517 (GRCm39) missense probably damaging 0.99
R6187:Vcpip1 UTSW 1 9,795,005 (GRCm39) missense probably damaging 1.00
R7042:Vcpip1 UTSW 1 9,818,378 (GRCm39) missense unknown
R7268:Vcpip1 UTSW 1 9,816,307 (GRCm39) missense probably damaging 0.99
R7417:Vcpip1 UTSW 1 9,816,540 (GRCm39) missense probably benign 0.00
R7464:Vcpip1 UTSW 1 9,816,745 (GRCm39) missense probably damaging 0.99
R8138:Vcpip1 UTSW 1 9,818,334 (GRCm39) small deletion probably benign
R8350:Vcpip1 UTSW 1 9,794,831 (GRCm39) missense probably benign
R8450:Vcpip1 UTSW 1 9,794,831 (GRCm39) missense probably benign
R9310:Vcpip1 UTSW 1 9,817,927 (GRCm39) missense possibly damaging 0.93
R9359:Vcpip1 UTSW 1 9,816,049 (GRCm39) missense possibly damaging 0.71
R9404:Vcpip1 UTSW 1 9,817,856 (GRCm39) missense probably damaging 1.00
R9564:Vcpip1 UTSW 1 9,817,456 (GRCm39) missense possibly damaging 0.94
R9572:Vcpip1 UTSW 1 9,816,770 (GRCm39) missense possibly damaging 0.92
R9598:Vcpip1 UTSW 1 9,816,019 (GRCm39) missense probably benign 0.02
R9716:Vcpip1 UTSW 1 9,815,948 (GRCm39) missense probably benign 0.00
Z1177:Vcpip1 UTSW 1 9,817,307 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAACTGGCTCCTTTTCCATC -3'
(R):5'- AGAATTGGAGTCGCAGCTAC -3'

Sequencing Primer
(F):5'- CTTTTCCATCCCTGCCTGG -3'
(R):5'- GTCGCAGCTACCAACTAAAATTATTC -3'
Posted On 2022-05-16