Incidental Mutation 'R9403:Vcpip1'
ID 711324
Institutional Source Beutler Lab
Gene Symbol Vcpip1
Ensembl Gene ENSMUSG00000045210
Gene Name valosin containing protein (p97)/p47 complex interacting protein 1
Synonyms 5730421J18Rik, Vcip135, 5730538E15Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 9718622-9748382 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9745824 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 778 (I778T)
Ref Sequence ENSEMBL: ENSMUSP00000051248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057438]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000057438
AA Change: I778T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051248
Gene: ENSMUSG00000045210
AA Change: I778T

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 19 36 N/A INTRINSIC
Pfam:OTU 213 354 3.3e-15 PFAM
low complexity region 754 772 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a deubiquitinating enzyme that interacts with valosin containing protein p97 and plays a role in the assembly of Golgi apparatus during mitosis. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Vcpip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02341:Vcpip1 APN 1 9724950 missense possibly damaging 0.75
IGL02888:Vcpip1 APN 1 9724786 missense probably damaging 0.98
IGL03246:Vcpip1 APN 1 9745957 missense probably benign 0.00
R0243:Vcpip1 UTSW 1 9747206 nonsense probably null
R0968:Vcpip1 UTSW 1 9746379 missense probably damaging 1.00
R1139:Vcpip1 UTSW 1 9746723 missense probably damaging 0.98
R1230:Vcpip1 UTSW 1 9725224 missense probably damaging 1.00
R1524:Vcpip1 UTSW 1 9724502 missense probably damaging 1.00
R1989:Vcpip1 UTSW 1 9745563 missense probably benign 0.11
R2135:Vcpip1 UTSW 1 9747810 missense probably benign 0.01
R2299:Vcpip1 UTSW 1 9745719 missense possibly damaging 0.71
R4692:Vcpip1 UTSW 1 9748074 missense unknown
R4855:Vcpip1 UTSW 1 9747364 missense probably damaging 1.00
R4883:Vcpip1 UTSW 1 9747198 missense probably damaging 1.00
R4891:Vcpip1 UTSW 1 9748062 missense unknown
R4897:Vcpip1 UTSW 1 9747347 missense probably damaging 0.97
R5141:Vcpip1 UTSW 1 9748077 missense unknown
R5465:Vcpip1 UTSW 1 9747147 missense probably benign 0.16
R5651:Vcpip1 UTSW 1 9747840 missense probably damaging 0.99
R5664:Vcpip1 UTSW 1 9746379 missense probably damaging 0.99
R6131:Vcpip1 UTSW 1 9747292 missense probably damaging 0.99
R6187:Vcpip1 UTSW 1 9724780 missense probably damaging 1.00
R7042:Vcpip1 UTSW 1 9748153 missense unknown
R7268:Vcpip1 UTSW 1 9746082 missense probably damaging 0.99
R7417:Vcpip1 UTSW 1 9746315 missense probably benign 0.00
R7464:Vcpip1 UTSW 1 9746520 missense probably damaging 0.99
R8138:Vcpip1 UTSW 1 9748109 small deletion probably benign
R8350:Vcpip1 UTSW 1 9724606 missense probably benign
R8450:Vcpip1 UTSW 1 9724606 missense probably benign
R9310:Vcpip1 UTSW 1 9747702 missense possibly damaging 0.93
R9359:Vcpip1 UTSW 1 9745824 missense possibly damaging 0.71
R9404:Vcpip1 UTSW 1 9747631 missense probably damaging 1.00
R9564:Vcpip1 UTSW 1 9747231 missense possibly damaging 0.94
R9572:Vcpip1 UTSW 1 9746545 missense possibly damaging 0.92
R9598:Vcpip1 UTSW 1 9745794 missense probably benign 0.02
Z1177:Vcpip1 UTSW 1 9747082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAACTGGCTCCTTTTCCATC -3'
(R):5'- AGAATTGGAGTCGCAGCTAC -3'

Sequencing Primer
(F):5'- CTTTTCCATCCCTGCCTGG -3'
(R):5'- GTCGCAGCTACCAACTAAAATTATTC -3'
Posted On 2022-05-16