Incidental Mutation 'R9403:Qsox1'
ID 711327
Institutional Source Beutler Lab
Gene Symbol Qsox1
Ensembl Gene ENSMUSG00000033684
Gene Name quiescin Q6 sulfhydryl oxidase 1
Synonyms Qscn6, QSOX, 1300003H02Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 155776029-155812889 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 155782597 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 409 (S409P)
Ref Sequence ENSEMBL: ENSMUSP00000035658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035325] [ENSMUST00000111764] [ENSMUST00000194632]
AlphaFold Q8BND5
PDB Structure C76A/C455S mutant of mouse QSOX1 containing an interdomain disulfide [X-RAY DIFFRACTION]
C76A/C455S mutant of mouse QSOX1 containing an interdomain disulfide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000035325
AA Change: S409P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035658
Gene: ENSMUSG00000033684
AA Change: S409P

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 46 149 9e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 507 7e-29 PFAM
low complexity region 679 692 N/A INTRINSIC
low complexity region 693 705 N/A INTRINSIC
transmembrane domain 709 731 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111764
AA Change: S409P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107394
Gene: ENSMUSG00000033684
AA Change: S409P

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 45 149 1.7e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 508 1.5e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194632
AA Change: S409P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142301
Gene: ENSMUSG00000033684
AA Change: S409P

DomainStartEndE-ValueType
low complexity region 5 29 N/A INTRINSIC
Pfam:Thioredoxin 45 149 1.3e-18 PFAM
low complexity region 276 286 N/A INTRINSIC
Pfam:Evr1_Alr 408 508 1.2e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains domains of thioredoxin and ERV1, members of two long-standing gene families. The gene expression is induced as fibroblasts begin to exit the proliferative cycle and enter quiescence, suggesting that this gene plays an important role in growth regulation. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for an ENU-induced mutation show cardiovascular phenotypes including persistent truncus arteriosus, atriventricular septal defects and vascular ring, as well as eye defects, short snout, micrognathia, cleft palate, tracheosophageal fistula, polydactyly and spleen hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Qsox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02392:Qsox1 APN 1 155812600 missense probably damaging 1.00
BB003:Qsox1 UTSW 1 155812787 missense unknown
BB013:Qsox1 UTSW 1 155812787 missense unknown
R1799:Qsox1 UTSW 1 155794618 missense probably null
R1833:Qsox1 UTSW 1 155791045 missense probably benign 0.15
R1874:Qsox1 UTSW 1 155812639 missense possibly damaging 0.85
R4282:Qsox1 UTSW 1 155786925 critical splice acceptor site probably null
R4938:Qsox1 UTSW 1 155779668 missense probably benign 0.01
R5081:Qsox1 UTSW 1 155812835 utr 5 prime probably benign
R5217:Qsox1 UTSW 1 155790996 missense probably benign 0.00
R5303:Qsox1 UTSW 1 155779293 missense probably benign 0.01
R5761:Qsox1 UTSW 1 155779528 missense probably benign
R5763:Qsox1 UTSW 1 155779879 missense probably benign
R5932:Qsox1 UTSW 1 155789333 missense probably benign
R6765:Qsox1 UTSW 1 155791105 missense probably benign 0.00
R6802:Qsox1 UTSW 1 155795393 missense probably damaging 1.00
R7926:Qsox1 UTSW 1 155812787 missense unknown
R8857:Qsox1 UTSW 1 155782587 missense possibly damaging 0.50
R8986:Qsox1 UTSW 1 155791083 missense probably damaging 1.00
R9359:Qsox1 UTSW 1 155782597 missense probably damaging 1.00
R9366:Qsox1 UTSW 1 155789416 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAACTGTATTCCTGCAAACACTTCC -3'
(R):5'- CAAGAAGATGGCTGTGGTGC -3'

Sequencing Primer
(F):5'- TCTGCCTCCCACTAATACAGG -3'
(R):5'- CTGTGGGCTCCTGGAAGCTTC -3'
Posted On 2022-05-16