Incidental Mutation 'R9403:Malrd1'
ID 711328
Institutional Source Beutler Lab
Gene Symbol Malrd1
Ensembl Gene ENSMUSG00000075520
Gene Name MAM and LDL receptor class A domain containing 1
Synonyms Diet1, Gm13364, Gm13318
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 15526479-16255555 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15614177 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 284 (V284A)
Ref Sequence ENSEMBL: ENSMUSP00000116869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146205]
AlphaFold A2AJX4
Predicted Effect
SMART Domains Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: V284A

DomainStartEndE-ValueType
Pfam:MAM 8 171 1.6e-36 PFAM
LDLa 181 219 6.89e-8 SMART
LDLa 225 262 4.37e-10 SMART
LDLa 264 303 9.55e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Malrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Malrd1 APN 2 16142186 splice site probably benign
IGL01295:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01296:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01399:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01400:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01401:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01402:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01405:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01406:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL02105:Malrd1 APN 2 16127863 missense unknown
IGL02581:Malrd1 APN 2 16142312 nonsense probably null
IGL03015:Malrd1 APN 2 16042271 missense unknown
IGL03038:Malrd1 APN 2 16127967 missense unknown
R1353:Malrd1 UTSW 2 16127968 missense unknown
R1385:Malrd1 UTSW 2 16042228 missense unknown
R2242:Malrd1 UTSW 2 16101944 missense unknown
R2888:Malrd1 UTSW 2 16074757 missense unknown
R4398:Malrd1 UTSW 2 16150783 missense unknown
R4982:Malrd1 UTSW 2 16042129 missense probably benign 0.29
R5148:Malrd1 UTSW 2 16142226 missense unknown
R5195:Malrd1 UTSW 2 16150810 missense unknown
R5828:Malrd1 UTSW 2 15526653 missense probably benign 0.00
R5892:Malrd1 UTSW 2 15614267 missense probably benign 0.03
R6034:Malrd1 UTSW 2 15845326 missense possibly damaging 0.78
R6034:Malrd1 UTSW 2 15845326 missense possibly damaging 0.78
R6195:Malrd1 UTSW 2 15695326 missense probably damaging 1.00
R6318:Malrd1 UTSW 2 16042267 missense unknown
R6438:Malrd1 UTSW 2 15614206 missense
R6457:Malrd1 UTSW 2 15526597 start gained probably benign
R6457:Malrd1 UTSW 2 15667929 missense probably benign 0.41
R6499:Malrd1 UTSW 2 15931689 missense probably benign 0.03
R6575:Malrd1 UTSW 2 15842628 missense probably benign 0.00
R6792:Malrd1 UTSW 2 16150756 missense unknown
R6796:Malrd1 UTSW 2 15869784 missense unknown
R6930:Malrd1 UTSW 2 15797667 missense unknown
R6959:Malrd1 UTSW 2 16218009 missense probably damaging 0.97
R6993:Malrd1 UTSW 2 16150791 missense unknown
R7102:Malrd1 UTSW 2 16142303 missense unknown
R7112:Malrd1 UTSW 2 15925176 missense unknown
R7248:Malrd1 UTSW 2 16101911 missense unknown
R7249:Malrd1 UTSW 2 15623340 missense probably damaging 0.97
R7334:Malrd1 UTSW 2 16006718 missense probably damaging 0.99
R7394:Malrd1 UTSW 2 15695199 missense unknown
R7399:Malrd1 UTSW 2 15610090 missense
R7476:Malrd1 UTSW 2 16142304 missense unknown
R7582:Malrd1 UTSW 2 15695270 missense unknown
R7604:Malrd1 UTSW 2 15925192 missense unknown
R7662:Malrd1 UTSW 2 15871454 missense unknown
R7681:Malrd1 UTSW 2 16218102 missense unknown
R7740:Malrd1 UTSW 2 15614215 missense not run
R7747:Malrd1 UTSW 2 16074835 missense unknown
R7754:Malrd1 UTSW 2 15797799 splice site probably null
R7950:Malrd1 UTSW 2 16128068 missense unknown
R8194:Malrd1 UTSW 2 15925120 missense unknown
R8260:Malrd1 UTSW 2 15614206 missense
R8314:Malrd1 UTSW 2 15752832 missense unknown
R8342:Malrd1 UTSW 2 15633224 missense unknown
R8386:Malrd1 UTSW 2 15696844 missense unknown
R8492:Malrd1 UTSW 2 15610123 missense
R8728:Malrd1 UTSW 2 15696942 nonsense probably null
R8756:Malrd1 UTSW 2 15752895 critical splice donor site probably null
R8869:Malrd1 UTSW 2 15565557 critical splice donor site probably null
R8888:Malrd1 UTSW 2 15845227 missense unknown
R8895:Malrd1 UTSW 2 15845227 missense unknown
R8902:Malrd1 UTSW 2 16255334 nonsense probably null
R8954:Malrd1 UTSW 2 15551367 missense
R8960:Malrd1 UTSW 2 15565430 nonsense probably null
R9005:Malrd1 UTSW 2 15845329 missense unknown
R9135:Malrd1 UTSW 2 15797705 missense unknown
R9267:Malrd1 UTSW 2 16255266 missense unknown
R9330:Malrd1 UTSW 2 16255278 missense unknown
R9359:Malrd1 UTSW 2 15614177 missense
R9383:Malrd1 UTSW 2 15695201 missense unknown
R9389:Malrd1 UTSW 2 15703156 missense unknown
R9454:Malrd1 UTSW 2 15752849 missense unknown
R9454:Malrd1 UTSW 2 15797726 nonsense probably null
R9520:Malrd1 UTSW 2 16074820 missense unknown
R9544:Malrd1 UTSW 2 15635998 missense unknown
Z1176:Malrd1 UTSW 2 16217845 missense unknown
Z1191:Malrd1 UTSW 2 16042226 missense unknown
Predicted Primers PCR Primer
(F):5'- TTAGGAGTGAACTGACATGTGT -3'
(R):5'- GTACACATGAAGACAAGCAGACC -3'

Sequencing Primer
(F):5'- GTGAACTGACATGTGTTATTAAAGC -3'
(R):5'- GCAGACCCACACTTACACATG -3'
Posted On 2022-05-16