Incidental Mutation 'R9403:Padi3'
ID 711333
Institutional Source Beutler Lab
Gene Symbol Padi3
Ensembl Gene ENSMUSG00000025328
Gene Name peptidyl arginine deiminase, type III
Synonyms PAD type III, Pdi3, Pad3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 140785365-140810648 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140810532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 26 (I26V)
Ref Sequence ENSEMBL: ENSMUSP00000026377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026377] [ENSMUST00000026378]
AlphaFold Q9Z184
Predicted Effect probably benign
Transcript: ENSMUST00000026377
AA Change: I26V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026377
Gene: ENSMUSG00000025328
AA Change: I26V

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 2.1e-38 PFAM
Pfam:PAD_M 115 273 4.2e-61 PFAM
Pfam:PAD 283 661 2.3e-169 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026378
SMART Domains Protein: ENSMUSP00000026378
Gene: ENSMUSG00000025329

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 5.4e-39 PFAM
Pfam:PAD_M 115 272 1.3e-63 PFAM
Pfam:PAD 280 659 9.4e-170 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type III enzyme modulates hair structural proteins, such as filaggrin in the hair follicle and trichohyalin in the inner root sheath, during hair follicle formation. Together with the type I enzyme, this enzyme may also play a role in terminal differentiation of the epidermis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit alterations in coat/ hair and vibrissa morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Padi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Padi3 APN 4 140803624 missense possibly damaging 0.78
IGL00948:Padi3 APN 4 140788943 missense possibly damaging 0.92
IGL00949:Padi3 APN 4 140788943 missense possibly damaging 0.92
IGL01021:Padi3 APN 4 140796334 splice site probably benign
IGL02400:Padi3 APN 4 140788868 missense probably benign 0.00
IGL02449:Padi3 APN 4 140789712 critical splice donor site probably null
IGL02600:Padi3 APN 4 140798156 missense probably benign 0.15
IGL03342:Padi3 APN 4 140810598 nonsense probably null
FR4304:Padi3 UTSW 4 140792972 critical splice donor site probably benign
PIT4544001:Padi3 UTSW 4 140791483 missense probably benign 0.00
R0455:Padi3 UTSW 4 140795713 missense probably damaging 1.00
R0743:Padi3 UTSW 4 140786429 missense probably benign 0.00
R1279:Padi3 UTSW 4 140803577 missense probably benign 0.00
R2081:Padi3 UTSW 4 140798979 missense probably damaging 1.00
R3016:Padi3 UTSW 4 140786587 missense probably damaging 1.00
R3853:Padi3 UTSW 4 140791269 splice site probably benign
R4599:Padi3 UTSW 4 140798111 missense probably damaging 1.00
R4909:Padi3 UTSW 4 140795626 missense probably damaging 1.00
R5370:Padi3 UTSW 4 140810538 nonsense probably null
R5482:Padi3 UTSW 4 140795843 missense probably damaging 0.99
R6084:Padi3 UTSW 4 140795843 missense probably damaging 1.00
R6151:Padi3 UTSW 4 140796394 missense probably damaging 1.00
R6277:Padi3 UTSW 4 140791161 critical splice donor site probably null
R6343:Padi3 UTSW 4 140803508 missense possibly damaging 0.58
R6749:Padi3 UTSW 4 140795853 missense possibly damaging 0.94
R7096:Padi3 UTSW 4 140800124 missense probably damaging 1.00
R7403:Padi3 UTSW 4 140800119 missense probably benign
R7798:Padi3 UTSW 4 140786439 missense probably benign
R7818:Padi3 UTSW 4 140798142 missense possibly damaging 0.72
R8375:Padi3 UTSW 4 140798096 missense probably damaging 1.00
R8887:Padi3 UTSW 4 140796484 nonsense probably null
R9036:Padi3 UTSW 4 140795693 missense probably benign 0.00
R9339:Padi3 UTSW 4 140795617 missense probably benign 0.11
RF025:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF032:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF040:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF043:Padi3 UTSW 4 140792972 critical splice donor site probably benign
Z1176:Padi3 UTSW 4 140795671 missense possibly damaging 0.92
Z1176:Padi3 UTSW 4 140798123 missense not run
Z1177:Padi3 UTSW 4 140798123 missense not run
Predicted Primers PCR Primer
(F):5'- TAAGTCCAATGTACGGAGCTCAG -3'
(R):5'- CAATAAGCTTGCGCCCTGAG -3'

Sequencing Primer
(F):5'- CTGGATCCTCAGGTTCAAAAAC -3'
(R):5'- TTGCGCCCTGAGCTGGAG -3'
Posted On 2022-05-16