Incidental Mutation 'R9403:Cyp3a41a'
ID 711335
Institutional Source Beutler Lab
Gene Symbol Cyp3a41a
Ensembl Gene ENSMUSG00000075551
Gene Name cytochrome P450, family 3, subfamily a, polypeptide 41A
Synonyms steroid inducible, Cyp3a41
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock # R9403 (G1)
Quality Score 91.0077
Status Not validated
Chromosome 5
Chromosomal Location 145694049-145720136 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 145702198 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 320 (Y320F)
Ref Sequence ENSEMBL: ENSMUSP00000091659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094111]
AlphaFold Q9JMA7
Predicted Effect probably damaging
Transcript: ENSMUST00000094111
AA Change: Y320F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091659
Gene: ENSMUSG00000075551
AA Change: Y320F

DomainStartEndE-ValueType
Pfam:p450 38 494 1.7e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Cyp3a41a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02284:Cyp3a41a APN 5 145704863 splice site probably benign
IGL03003:Cyp3a41a APN 5 145705830 missense probably benign
R0006:Cyp3a41a UTSW 5 145704796 missense probably benign 0.01
R0515:Cyp3a41a UTSW 5 145718000 missense probably damaging 1.00
R1052:Cyp3a41a UTSW 5 145705811 missense possibly damaging 0.49
R3708:Cyp3a41a UTSW 5 145717923 critical splice donor site probably null
R4049:Cyp3a41a UTSW 5 145713540 missense probably damaging 1.00
R4755:Cyp3a41a UTSW 5 145715506 missense probably damaging 1.00
R4975:Cyp3a41a UTSW 5 145720048 start codon destroyed probably null 1.00
R6519:Cyp3a41a UTSW 5 145715498 missense probably damaging 1.00
R6788:Cyp3a41a UTSW 5 145705829 missense probably benign 0.00
R7184:Cyp3a41a UTSW 5 145705853 missense probably benign 0.01
R7372:Cyp3a41a UTSW 5 145713564 missense possibly damaging 0.67
R7451:Cyp3a41a UTSW 5 145699740 missense probably benign 0.10
R7463:Cyp3a41a UTSW 5 145713564 missense probably damaging 1.00
R7766:Cyp3a41a UTSW 5 145718017 missense probably damaging 0.99
R9179:Cyp3a41a UTSW 5 145705844 missense probably benign
R9225:Cyp3a41a UTSW 5 145713604 missense probably benign 0.03
R9300:Cyp3a41a UTSW 5 145720096 start gained probably benign
R9308:Cyp3a41a UTSW 5 145720048 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTCACTCACACACGGAG -3'
(R):5'- TGCTGGCATGGTGAAGACAG -3'

Sequencing Primer
(F):5'- TCACACACGGAGACTCTATTTC -3'
(R):5'- GTGTGACTGAACACCATTTCCATAG -3'
Posted On 2022-05-16