Incidental Mutation 'R9403:Slc2a3'
ID 711339
Institutional Source Beutler Lab
Gene Symbol Slc2a3
Ensembl Gene ENSMUSG00000003153
Gene Name solute carrier family 2 (facilitated glucose transporter), member 3
Synonyms Glut-3, Glut3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 122727809-122801640 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 122736610 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 214 (I214M)
Ref Sequence ENSEMBL: ENSMUSP00000032476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032476] [ENSMUST00000165884] [ENSMUST00000166135] [ENSMUST00000168801] [ENSMUST00000170724] [ENSMUST00000171541]
AlphaFold P32037
Predicted Effect probably damaging
Transcript: ENSMUST00000032476
AA Change: I214M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032476
Gene: ENSMUSG00000003153
AA Change: I214M

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 465 5.9e-165 PFAM
Pfam:MFS_1 16 385 7.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165884
SMART Domains Protein: ENSMUSP00000129925
Gene: ENSMUSG00000003153

DomainStartEndE-ValueType
Pfam:MFS_1 13 163 3.6e-12 PFAM
Pfam:Sugar_tr 15 163 6.9e-49 PFAM
Pfam:MFS_2 43 148 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166135
SMART Domains Protein: ENSMUSP00000132586
Gene: ENSMUSG00000003153

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 63 9.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168801
SMART Domains Protein: ENSMUSP00000129604
Gene: ENSMUSG00000003153

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 70 1.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170724
SMART Domains Protein: ENSMUSP00000128076
Gene: ENSMUSG00000003153

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 89 5.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171541
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutations cause embryonic lethality. Heterozygotes for a null allele show partial perinatal lethality and impaired placental transport. Heterozygotes for a gene trap allele show abnormal brain wave patterns, increased startle reflex, reduced prepulse inhibition and increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Slc2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Slc2a3 APN 6 122729956 missense probably benign
IGL02056:Slc2a3 APN 6 122735478 missense probably damaging 0.99
IGL02267:Slc2a3 APN 6 122739972 missense probably benign 0.00
IGL02873:Slc2a3 APN 6 122740414 missense probably damaging 0.98
IGL03275:Slc2a3 APN 6 122736742 critical splice acceptor site probably null
R1014:Slc2a3 UTSW 6 122731566 missense possibly damaging 0.77
R1464:Slc2a3 UTSW 6 122737310 splice site probably benign
R1920:Slc2a3 UTSW 6 122736741 missense probably damaging 0.99
R1990:Slc2a3 UTSW 6 122736735 missense probably damaging 1.00
R3809:Slc2a3 UTSW 6 122732429 missense probably benign 0.03
R4094:Slc2a3 UTSW 6 122735568 missense probably benign 0.23
R4537:Slc2a3 UTSW 6 122737104 missense probably damaging 1.00
R5093:Slc2a3 UTSW 6 122737237 missense probably damaging 0.99
R5186:Slc2a3 UTSW 6 122735583 missense probably damaging 1.00
R5784:Slc2a3 UTSW 6 122735417 splice site probably null
R9087:Slc2a3 UTSW 6 122740449 missense probably benign 0.35
R9636:Slc2a3 UTSW 6 122732403 missense probably damaging 0.98
R9639:Slc2a3 UTSW 6 122737240 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGTCAGCAAAAGTCCACAATC -3'
(R):5'- ACGGTACCTAATGATACAGGCAGG -3'

Sequencing Primer
(F):5'- TCAGAAAACTCTTCCTGCACATGG -3'
(R):5'- TGGTGCAATTATGGCATAGAAATAC -3'
Posted On 2022-05-16