Incidental Mutation 'R9403:Rergl'
ID 711340
Institutional Source Beutler Lab
Gene Symbol Rergl
Ensembl Gene ENSMUSG00000092164
Gene Name RERG/RAS-like
Synonyms EG632971
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 139492973-139501976 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 139494854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 99 (Y99F)
Ref Sequence ENSEMBL: ENSMUSP00000131303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170650]
AlphaFold B2RVE2
Predicted Effect possibly damaging
Transcript: ENSMUST00000170650
AA Change: Y99F

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131303
Gene: ENSMUSG00000092164
AA Change: Y99F

DomainStartEndE-ValueType
Pfam:Ras 5 173 7.7e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Rergl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Rergl APN 6 139493258 nonsense probably null
IGL01542:Rergl APN 6 139493498 critical splice acceptor site probably null
IGL01761:Rergl APN 6 139501865 missense probably damaging 0.96
IGL02236:Rergl APN 6 139494920 missense probably benign 0.25
IGL02507:Rergl APN 6 139493353 missense probably damaging 1.00
IGL02523:Rergl APN 6 139496460 splice site probably benign
R0518:Rergl UTSW 6 139496526 missense probably damaging 1.00
R0521:Rergl UTSW 6 139496526 missense probably damaging 1.00
R2086:Rergl UTSW 6 139494834 missense probably benign
R4629:Rergl UTSW 6 139501852 missense probably damaging 1.00
R5275:Rergl UTSW 6 139501821 critical splice donor site probably null
R6364:Rergl UTSW 6 139500748 missense probably damaging 1.00
R7175:Rergl UTSW 6 139496535 missense probably benign 0.01
R8808:Rergl UTSW 6 139501867 missense probably benign 0.18
R9033:Rergl UTSW 6 139494902 missense probably damaging 1.00
Z1088:Rergl UTSW 6 139493426 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATGATTCTGCTCGTGAGTG -3'
(R):5'- CCATTAAGTGAAGCAAAGAACTCGG -3'

Sequencing Primer
(F):5'- GTCAGCCAGGGTATAAAGCATTCTC -3'
(R):5'- ACTCGGAAGTGCGATCAC -3'
Posted On 2022-05-16