Incidental Mutation 'R9403:Zfp383'
ID 711341
Institutional Source Beutler Lab
Gene Symbol Zfp383
Ensembl Gene ENSMUSG00000099689
Gene Name zinc finger protein 383
Synonyms 1110003H10Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 29908223-29916813 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29915259 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 313 (F313S)
Ref Sequence ENSEMBL: ENSMUSP00000140742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186475] [ENSMUST00000187028]
AlphaFold A0A087WRR7
Predicted Effect possibly damaging
Transcript: ENSMUST00000186475
AA Change: F313S

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140742
Gene: ENSMUSG00000099689
AA Change: F313S

DomainStartEndE-ValueType
KRAB 27 87 4.95e-37 SMART
low complexity region 165 173 N/A INTRINSIC
ZnF_C2H2 185 207 1.47e-3 SMART
ZnF_C2H2 213 235 7.15e-2 SMART
ZnF_C2H2 241 263 1.79e-2 SMART
ZnF_C2H2 269 291 4.17e-3 SMART
ZnF_C2H2 297 319 3.69e-4 SMART
ZnF_C2H2 325 347 2.27e-4 SMART
ZnF_C2H2 353 375 1.84e-4 SMART
ZnF_C2H2 381 403 6.52e-5 SMART
ZnF_C2H2 409 431 1.58e-3 SMART
ZnF_C2H2 437 459 1.69e-3 SMART
ZnF_C2H2 465 487 1.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187028
SMART Domains Protein: ENSMUSP00000141019
Gene: ENSMUSG00000099689

DomainStartEndE-ValueType
KRAB 27 87 5.6e-22 SMART
low complexity region 124 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a KRAB-related zinc finger protein that inhibits the transcription of some MAPK signaling pathway genes. The repressor activity resides in the KRAB domain of the encoded protein. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Other mutations in Zfp383
AlleleSourceChrCoordTypePredicted EffectPPH Score
flyer UTSW 7 29914727 missense probably benign
Nonstarter UTSW 7 29908646 start codon destroyed probably null 0.01
R4796:Zfp383 UTSW 7 29914838 missense possibly damaging 0.72
R5114:Zfp383 UTSW 7 29914741 missense probably damaging 1.00
R5372:Zfp383 UTSW 7 29915270 nonsense probably null
R5622:Zfp383 UTSW 7 29912190 missense probably damaging 1.00
R5963:Zfp383 UTSW 7 29915678 missense possibly damaging 0.84
R6639:Zfp383 UTSW 7 29914727 missense probably benign
R6952:Zfp383 UTSW 7 29914955 missense probably benign 0.00
R7067:Zfp383 UTSW 7 29908646 start codon destroyed probably null 0.01
R7635:Zfp383 UTSW 7 29915271 missense probably damaging 1.00
R7809:Zfp383 UTSW 7 29910236 missense possibly damaging 0.86
R7839:Zfp383 UTSW 7 29915058 missense probably damaging 1.00
R7896:Zfp383 UTSW 7 29912201 missense probably damaging 0.99
R9006:Zfp383 UTSW 7 29908645 start codon destroyed probably null 0.00
R9013:Zfp383 UTSW 7 29915292 missense probably damaging 1.00
Z1186:Zfp383 UTSW 7 29914715 missense probably benign
Z1186:Zfp383 UTSW 7 29914721 missense probably benign
Z1186:Zfp383 UTSW 7 29915765 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCACATTCTTTCAGCAGACCT -3'
(R):5'- CAGCTATGGGGCTTGTCAT -3'

Sequencing Primer
(F):5'- CACTGGTGAAAAGCCCTTTG -3'
(R):5'- AAAGGTTTCTCGCCAGCATG -3'
Posted On 2022-05-16