Incidental Mutation 'R9403:Gm5591'
ID 711343
Institutional Source Beutler Lab
Gene Symbol Gm5591
Ensembl Gene ENSMUSG00000060565
Gene Name predicted gene 5591
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock # R9403 (G1)
Quality Score 191.009
Status Not validated
Chromosome 7
Chromosomal Location 38518139-38528193 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38520148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 434 (M434L)
Ref Sequence ENSEMBL: ENSMUSP00000078695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079759]
AlphaFold Q8CDK1
Predicted Effect probably benign
Transcript: ENSMUST00000079759
AA Change: M434L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000078695
Gene: ENSMUSG00000060565
AA Change: M434L

DomainStartEndE-ValueType
low complexity region 319 330 N/A INTRINSIC
Pfam:DUF4629 437 582 1.2e-59 PFAM
low complexity region 648 660 N/A INTRINSIC
low complexity region 693 704 N/A INTRINSIC
low complexity region 711 723 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Gm5591
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm5591 APN 7 38520414 missense probably benign 0.20
IGL02277:Gm5591 APN 7 38520432 missense probably damaging 0.98
IGL02277:Gm5591 APN 7 38519038 missense possibly damaging 0.92
IGL02503:Gm5591 APN 7 38520009 missense probably damaging 1.00
IGL02897:Gm5591 APN 7 38520042 missense probably damaging 1.00
IGL02899:Gm5591 APN 7 38519418 missense probably damaging 1.00
R1599:Gm5591 UTSW 7 38520370 missense probably benign
R2365:Gm5591 UTSW 7 38519401 missense probably damaging 1.00
R3054:Gm5591 UTSW 7 38520634 missense probably benign 0.35
R4619:Gm5591 UTSW 7 38520648 missense probably benign 0.04
R4722:Gm5591 UTSW 7 38519148 missense probably damaging 1.00
R4779:Gm5591 UTSW 7 38522256 missense probably damaging 0.96
R5079:Gm5591 UTSW 7 38522136 missense probably benign 0.01
R5237:Gm5591 UTSW 7 38522207 missense probably benign 0.31
R5267:Gm5591 UTSW 7 38518914 missense possibly damaging 0.94
R6337:Gm5591 UTSW 7 38521895 missense probably benign 0.00
R6458:Gm5591 UTSW 7 38519035 missense probably damaging 1.00
R6671:Gm5591 UTSW 7 38520099 missense possibly damaging 0.71
R6709:Gm5591 UTSW 7 38522075 missense probably benign 0.31
R6874:Gm5591 UTSW 7 38520291 missense probably damaging 0.97
R6917:Gm5591 UTSW 7 38522190 missense probably damaging 0.99
R6993:Gm5591 UTSW 7 38519223 missense probably benign
R7446:Gm5591 UTSW 7 38519509 missense probably benign 0.16
R7519:Gm5591 UTSW 7 38520670 missense possibly damaging 0.70
R7596:Gm5591 UTSW 7 38520184 missense probably benign
R7923:Gm5591 UTSW 7 38521914 missense probably benign 0.13
R8003:Gm5591 UTSW 7 38519759 missense probably damaging 0.96
R8027:Gm5591 UTSW 7 38522298 missense probably damaging 0.99
R8058:Gm5591 UTSW 7 38518939 missense probably benign 0.00
R8242:Gm5591 UTSW 7 38520322 missense probably benign
R8719:Gm5591 UTSW 7 38522190 missense probably benign 0.03
R8943:Gm5591 UTSW 7 38520303 missense probably benign 0.21
R9228:Gm5591 UTSW 7 38528061 start codon destroyed probably benign
R9314:Gm5591 UTSW 7 38522460 missense probably benign 0.00
R9403:Gm5591 UTSW 7 38522256 missense probably damaging 0.96
R9424:Gm5591 UTSW 7 38520297 missense probably damaging 1.00
RF052:Gm5591 UTSW 7 38522575 frame shift probably null
RF062:Gm5591 UTSW 7 38522335 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGCCCTCCAGATGCTTTGAG -3'
(R):5'- ACCCTGACTGCACTGATACAAG -3'

Sequencing Primer
(F):5'- CCCTCCAGATGCTTTGAGATGTTG -3'
(R):5'- GTCTAAGACCGAAATCTGCTTCTGAC -3'
Posted On 2022-05-16