Incidental Mutation 'R9403:Sh2b1'
ID 711345
Institutional Source Beutler Lab
Gene Symbol Sh2b1
Ensembl Gene ENSMUSG00000030733
Gene Name SH2B adaptor protein 1
Synonyms Irip, SH2-Bb, SH2-B, Sh2bpsm1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock # R9403 (G1)
Quality Score 217.468
Status Not validated
Chromosome 7
Chromosomal Location 126466994-126475424 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC at 126467570 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032974] [ENSMUST00000032978] [ENSMUST00000205340] [ENSMUST00000205440] [ENSMUST00000205497] [ENSMUST00000205733] [ENSMUST00000205889] [ENSMUST00000206664]
AlphaFold Q91ZM2
Predicted Effect probably benign
Transcript: ENSMUST00000032974
SMART Domains Protein: ENSMUSP00000032974
Gene: ENSMUSG00000030730

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.39e-16 SMART
Pfam:E1-E2_ATPase 92 340 1.5e-66 PFAM
Pfam:Hydrolase 345 715 7.5e-20 PFAM
Pfam:HAD 348 712 1.2e-18 PFAM
Pfam:Cation_ATPase 418 528 3.2e-23 PFAM
Pfam:Hydrolase_3 683 747 2.3e-7 PFAM
Pfam:Cation_ATPase_C 784 987 4.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032978
SMART Domains Protein: ENSMUSP00000032978
Gene: ENSMUSG00000030733

DomainStartEndE-ValueType
Pfam:Phe_ZIP 25 81 4.6e-25 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 133 151 N/A INTRINSIC
low complexity region 156 168 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
PH 247 378 4.82e-7 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 466 483 N/A INTRINSIC
SH2 525 610 2.84e-23 SMART
low complexity region 668 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205340
Predicted Effect probably benign
Transcript: ENSMUST00000205440
Predicted Effect probably benign
Transcript: ENSMUST00000205497
Predicted Effect probably benign
Transcript: ENSMUST00000205733
Predicted Effect probably benign
Transcript: ENSMUST00000205889
Predicted Effect probably benign
Transcript: ENSMUST00000206664
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SH2-domain containing mediators family. The encoded protein mediates activation of various kinases and may function in cytokine and growth factor receptor signaling and cellular transformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice are infertile. Female mice have small, anovulatory ovaries with reduced numbers of follicles and male mice exhibit small testes and sperm deficits. Mice homozygous for a floxed allele activated in the pancreas exhibit impaired glucose homeostasis when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Sh2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Sh2b1 APN 7 126469293 missense probably damaging 0.99
IGL02320:Sh2b1 APN 7 126469169 missense probably benign 0.02
IGL02589:Sh2b1 APN 7 126469268 missense probably benign 0.19
IGL02668:Sh2b1 APN 7 126472474 missense possibly damaging 0.62
IGL03189:Sh2b1 APN 7 126468530 missense possibly damaging 0.61
R0130:Sh2b1 UTSW 7 126471448 missense possibly damaging 0.95
R0532:Sh2b1 UTSW 7 126472272 missense probably benign 0.00
R2081:Sh2b1 UTSW 7 126472690 missense possibly damaging 0.62
R2109:Sh2b1 UTSW 7 126472364 missense possibly damaging 0.74
R2409:Sh2b1 UTSW 7 126471479 missense probably damaging 1.00
R2566:Sh2b1 UTSW 7 126468926 missense probably damaging 0.99
R3752:Sh2b1 UTSW 7 126468787 missense probably damaging 1.00
R4675:Sh2b1 UTSW 7 126471446 missense possibly damaging 0.79
R4970:Sh2b1 UTSW 7 126468803 missense probably damaging 1.00
R5102:Sh2b1 UTSW 7 126471236 missense probably benign
R5912:Sh2b1 UTSW 7 126471470 missense probably damaging 1.00
R7368:Sh2b1 UTSW 7 126468513 missense possibly damaging 0.59
R7694:Sh2b1 UTSW 7 126467757 missense probably benign 0.03
R7801:Sh2b1 UTSW 7 126471292 missense probably benign 0.15
R8005:Sh2b1 UTSW 7 126469307 missense possibly damaging 0.82
R8353:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8356:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8453:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8456:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8456:Sh2b1 UTSW 7 126467600 nonsense probably null
R8683:Sh2b1 UTSW 7 126467571 utr 3 prime probably benign
R8906:Sh2b1 UTSW 7 126471120 critical splice donor site probably null
R8921:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8922:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9000:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9000:Sh2b1 UTSW 7 126467571 utr 3 prime probably benign
R9269:Sh2b1 UTSW 7 126469182 missense probably damaging 0.99
R9284:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9284:Sh2b1 UTSW 7 126467575 utr 3 prime probably benign
R9284:Sh2b1 UTSW 7 126467592 utr 3 prime probably benign
R9285:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9285:Sh2b1 UTSW 7 126467579 utr 3 prime probably benign
R9285:Sh2b1 UTSW 7 126467593 utr 3 prime probably benign
R9286:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9287:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9287:Sh2b1 UTSW 7 126467578 utr 3 prime probably benign
R9287:Sh2b1 UTSW 7 126467591 utr 3 prime probably benign
R9287:Sh2b1 UTSW 7 126467599 utr 3 prime probably benign
R9398:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9398:Sh2b1 UTSW 7 126467574 utr 3 prime probably benign
R9398:Sh2b1 UTSW 7 126467584 utr 3 prime probably benign
R9399:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9399:Sh2b1 UTSW 7 126467572 utr 3 prime probably benign
R9399:Sh2b1 UTSW 7 126467578 utr 3 prime probably benign
R9399:Sh2b1 UTSW 7 126467590 utr 3 prime probably benign
R9403:Sh2b1 UTSW 7 126467573 nonsense probably null
R9403:Sh2b1 UTSW 7 126467575 utr 3 prime probably benign
R9404:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9404:Sh2b1 UTSW 7 126467599 utr 3 prime probably benign
R9467:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9467:Sh2b1 UTSW 7 126467582 nonsense probably null
R9482:Sh2b1 UTSW 7 126467596 utr 3 prime probably benign
R9495:Sh2b1 UTSW 7 126467572 utr 3 prime probably benign
R9507:Sh2b1 UTSW 7 126467588 utr 3 prime probably benign
R9511:Sh2b1 UTSW 7 126467578 utr 3 prime probably benign
R9514:Sh2b1 UTSW 7 126467578 utr 3 prime probably benign
R9514:Sh2b1 UTSW 7 126467593 utr 3 prime probably benign
R9514:Sh2b1 UTSW 7 126467598 utr 3 prime probably benign
Z1176:Sh2b1 UTSW 7 126467731 missense probably benign 0.23
Z1177:Sh2b1 UTSW 7 126471123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCAGGTATCTCACACAAATG -3'
(R):5'- TCACTTCCTTCCACAAGCAATG -3'

Sequencing Primer
(F):5'- CAGGTATCTCACACAAATGAGTACTG -3'
(R):5'- ACAAGCAATGTCTTCTCACCATTC -3'
Posted On 2022-05-16