Incidental Mutation 'R9403:Dock1'
ID 711348
Institutional Source Beutler Lab
Gene Symbol Dock1
Ensembl Gene ENSMUSG00000058325
Gene Name dedicator of cytokinesis 1
Synonyms D630004B07Rik, Dock180, 9130006G06Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 134670654-135173639 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 135168396 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1795 (V1795A)
Ref Sequence ENSEMBL: ENSMUSP00000081531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084488]
AlphaFold Q8BUR4
PDB Structure Solution structure of the SH3 domain of DOCK180 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000084488
AA Change: V1795A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325
AA Change: V1795A

DomainStartEndE-ValueType
SH3 12 69 7.57e-17 SMART
Pfam:DOCK_N 72 416 1.7e-113 PFAM
Pfam:DOCK-C2 421 618 1.2e-61 PFAM
low complexity region 628 639 N/A INTRINSIC
Pfam:DHR-2 1111 1610 3.3e-102 PFAM
low complexity region 1639 1664 N/A INTRINSIC
low complexity region 1683 1701 N/A INTRINSIC
low complexity region 1756 1773 N/A INTRINSIC
low complexity region 1823 1857 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Dedicator of cytokinesis proteins act as guanine nucleotide exchange factors for small Rho family G proteins. The encoded protein regulates the small GTPase Rac, thereby influencing several biological processes, including phagocytosis and cell migration. Overexpression of this gene has also been associated with certain cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with abnormal muscle development and failure of lungs to inflate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Dock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Dock1 APN 7 135146531 splice site probably benign
IGL01319:Dock1 APN 7 134789278 missense probably benign
IGL01390:Dock1 APN 7 134745047 missense possibly damaging 0.95
IGL01394:Dock1 APN 7 134766216 missense probably benign 0.01
IGL01489:Dock1 APN 7 134999321 splice site probably benign
IGL01505:Dock1 APN 7 135158510 missense possibly damaging 0.91
IGL01586:Dock1 APN 7 134753377 missense probably damaging 1.00
IGL01637:Dock1 APN 7 135137813 critical splice acceptor site probably null
IGL01649:Dock1 APN 7 134777410 missense probably damaging 1.00
IGL01652:Dock1 APN 7 134777497 splice site probably benign
IGL01859:Dock1 APN 7 135077161 missense possibly damaging 0.51
IGL02068:Dock1 APN 7 134771548 missense probably benign 0.26
IGL02168:Dock1 APN 7 135077131 splice site probably benign
IGL02200:Dock1 APN 7 134744271 missense probably benign 0.01
IGL02244:Dock1 APN 7 134777445 nonsense probably null
IGL02285:Dock1 APN 7 135081920 critical splice donor site probably null
IGL02319:Dock1 APN 7 134772449 missense possibly damaging 0.94
IGL02334:Dock1 APN 7 135145565 missense probably damaging 1.00
IGL02338:Dock1 APN 7 135133075 missense possibly damaging 0.95
IGL02351:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02358:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02607:Dock1 APN 7 134851513 missense probably benign 0.13
IGL02638:Dock1 APN 7 135146480 missense probably benign 0.09
IGL02724:Dock1 APN 7 135163353 missense probably benign
IGL02820:Dock1 APN 7 135167215 missense probably benign 0.11
IGL02950:Dock1 APN 7 134730024 missense probably damaging 1.00
IGL02993:Dock1 APN 7 134744298 missense probably benign
IGL03000:Dock1 APN 7 134789240 missense probably benign 0.17
IGL03092:Dock1 APN 7 134765216 splice site probably benign
IGL03131:Dock1 APN 7 134874183 missense possibly damaging 0.80
IGL03136:Dock1 APN 7 135168389 missense probably benign 0.00
IGL03210:Dock1 APN 7 134756939 missense possibly damaging 0.62
IGL03220:Dock1 APN 7 135108522 critical splice donor site probably null
P0028:Dock1 UTSW 7 134999324 splice site probably benign
PIT4453001:Dock1 UTSW 7 135152300 missense probably benign
R0003:Dock1 UTSW 7 134730064 splice site probably benign
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0179:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0180:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0347:Dock1 UTSW 7 134763867 missense probably damaging 1.00
R0399:Dock1 UTSW 7 135163442 missense probably benign 0.00
R0457:Dock1 UTSW 7 135138145 missense possibly damaging 0.90
R0480:Dock1 UTSW 7 134737718 missense probably damaging 1.00
R0521:Dock1 UTSW 7 135143778 missense probably benign 0.21
R0792:Dock1 UTSW 7 134874150 missense probably benign 0.02
R1136:Dock1 UTSW 7 134848173 missense possibly damaging 0.95
R1224:Dock1 UTSW 7 135108819 missense possibly damaging 0.67
R1267:Dock1 UTSW 7 134746436 missense probably damaging 1.00
R1373:Dock1 UTSW 7 135167175 missense probably benign 0.01
R1401:Dock1 UTSW 7 135133936 nonsense probably null
R1454:Dock1 UTSW 7 134851609 splice site probably benign
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1523:Dock1 UTSW 7 134744247 missense possibly damaging 0.49
R1643:Dock1 UTSW 7 135098779 missense probably damaging 1.00
R1659:Dock1 UTSW 7 134789243 missense probably damaging 0.98
R1793:Dock1 UTSW 7 135098727 splice site probably null
R1864:Dock1 UTSW 7 135146507 missense probably benign 0.07
R1911:Dock1 UTSW 7 134999300 missense probably damaging 1.00
R2567:Dock1 UTSW 7 135145484 missense probably damaging 1.00
R3816:Dock1 UTSW 7 134744286 nonsense probably null
R3971:Dock1 UTSW 7 134746908 missense probably damaging 1.00
R4063:Dock1 UTSW 7 135115292 missense possibly damaging 0.81
R4163:Dock1 UTSW 7 134744322 missense possibly damaging 0.79
R4271:Dock1 UTSW 7 134734054 missense probably damaging 0.99
R4684:Dock1 UTSW 7 134724409 nonsense probably null
R4717:Dock1 UTSW 7 134848170 missense probably damaging 1.00
R4725:Dock1 UTSW 7 134745014 nonsense probably null
R4788:Dock1 UTSW 7 135145484 missense probably damaging 0.98
R4869:Dock1 UTSW 7 134734071 missense probably damaging 1.00
R4889:Dock1 UTSW 7 134744976 missense probably benign 0.02
R4953:Dock1 UTSW 7 135152288 missense probably benign 0.34
R5031:Dock1 UTSW 7 135152246 missense probably benign 0.02
R5161:Dock1 UTSW 7 134734062 missense possibly damaging 0.69
R5168:Dock1 UTSW 7 135118908 missense probably damaging 1.00
R5212:Dock1 UTSW 7 134789194 missense possibly damaging 0.68
R5648:Dock1 UTSW 7 134746954 missense probably damaging 1.00
R5685:Dock1 UTSW 7 134772362 missense probably benign 0.19
R5834:Dock1 UTSW 7 134763933 missense probably damaging 1.00
R6181:Dock1 UTSW 7 135158522 missense probably damaging 1.00
R6334:Dock1 UTSW 7 134851576 missense probably benign 0.01
R6406:Dock1 UTSW 7 135145486 missense probably benign 0.26
R6425:Dock1 UTSW 7 135163381 missense possibly damaging 0.79
R6489:Dock1 UTSW 7 134990541 missense probably damaging 0.99
R6616:Dock1 UTSW 7 135108492 missense possibly damaging 0.85
R6706:Dock1 UTSW 7 135133886 missense possibly damaging 0.72
R6766:Dock1 UTSW 7 134756793 splice site probably null
R6861:Dock1 UTSW 7 134771478 missense probably benign 0.00
R6985:Dock1 UTSW 7 135163403 missense possibly damaging 0.95
R7259:Dock1 UTSW 7 134782748 missense probably damaging 0.99
R7285:Dock1 UTSW 7 134745008 missense probably benign 0.01
R7471:Dock1 UTSW 7 135163343 missense possibly damaging 0.65
R7497:Dock1 UTSW 7 134765274 missense probably benign
R7691:Dock1 UTSW 7 135138157 critical splice donor site probably null
R7732:Dock1 UTSW 7 134744970 missense probably benign 0.01
R7818:Dock1 UTSW 7 134763865 missense probably damaging 1.00
R7918:Dock1 UTSW 7 135145418 missense probably damaging 1.00
R7960:Dock1 UTSW 7 135077188 missense possibly damaging 0.83
R7961:Dock1 UTSW 7 134745057 missense possibly damaging 0.77
R7985:Dock1 UTSW 7 134746954 missense possibly damaging 0.95
R8009:Dock1 UTSW 7 134745057 missense possibly damaging 0.77
R8060:Dock1 UTSW 7 135168403 missense probably benign
R8060:Dock1 UTSW 7 134990629 splice site probably benign
R8061:Dock1 UTSW 7 134772323 missense probably benign 0.00
R8101:Dock1 UTSW 7 134999288 missense possibly damaging 0.89
R8405:Dock1 UTSW 7 134777463 missense probably benign 0.04
R8508:Dock1 UTSW 7 134782409 missense probably benign 0.00
R8803:Dock1 UTSW 7 134874087 missense probably benign 0.28
R9007:Dock1 UTSW 7 134899096 intron probably benign
R9026:Dock1 UTSW 7 135119017 missense probably damaging 0.97
R9111:Dock1 UTSW 7 134999288 missense possibly damaging 0.89
R9359:Dock1 UTSW 7 135168396 missense probably benign
R9398:Dock1 UTSW 7 135172499 missense probably damaging 0.99
R9408:Dock1 UTSW 7 135115336 missense probably damaging 0.99
R9476:Dock1 UTSW 7 134990550 missense probably benign 0.10
R9478:Dock1 UTSW 7 134766233 missense probably damaging 1.00
R9510:Dock1 UTSW 7 134990550 missense probably benign 0.10
R9544:Dock1 UTSW 7 134746457 missense possibly damaging 0.71
R9605:Dock1 UTSW 7 134782412 missense possibly damaging 0.49
R9657:Dock1 UTSW 7 134737700 missense possibly damaging 0.58
R9767:Dock1 UTSW 7 134741067 missense possibly damaging 0.68
X0062:Dock1 UTSW 7 135108451 missense probably damaging 1.00
Z1088:Dock1 UTSW 7 134804547 missense probably damaging 0.98
Z1177:Dock1 UTSW 7 134782400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTATGCGGATGCCACTAAGG -3'
(R):5'- CATGCATACCTCAGTCCTGG -3'

Sequencing Primer
(F):5'- CAGAGAGTTGATACGTTGCTTCAAGC -3'
(R):5'- ATACCTCAGTCCTGGCTGCG -3'
Posted On 2022-05-16