Mutagenetix > Incidental Mutation

Incidental Mutation 'R9403:Dock1'

711348

Institutional Source

Beutler Lab

Gene Symbol

Dock1

Ensembl Gene

ENSMUSG00000058325

Gene Name

dedicator of cytokinesis 1

Synonyms

D630004B07Rik, Dock180, 9130006G06Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9403 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

134670654-135173639 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135168396 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1795 (V1795A)

Ref Sequence

ENSEMBL: ENSMUSP00000081531 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084488]

AlphaFold

Q8BUR4

PDB Structure

Solution structure of the SH3 domain of DOCK180 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000084488
AA Change: V1795A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325
AA Change: V1795A

Domain	Start	End	E-Value	Type
SH3	12	69	7.57e-17	SMART
Pfam:DOCK_N	72	416	1.7e-113	PFAM
Pfam:DOCK-C2	421	618	1.2e-61	PFAM
low complexity region	628	639	N/A	INTRINSIC
Pfam:DHR-2	1111	1610	3.3e-102	PFAM
low complexity region	1639	1664	N/A	INTRINSIC
low complexity region	1683	1701	N/A	INTRINSIC
low complexity region	1756	1773	N/A	INTRINSIC
low complexity region	1823	1857	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Dedicator of cytokinesis proteins act as guanine nucleotide exchange factors for small Rho family G proteins. The encoded protein regulates the small GTPase Rac, thereby influencing several biological processes, including phagocytosis and cell migration. Overexpression of this gene has also been associated with certain cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with abnormal muscle development and failure of lungs to inflate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	T	G	6: 96,165,299	T255P	probably benign	Het
4930444G20Rik	C	T	10: 22,067,941	D47N	possibly damaging	Het
Angpt4	C	T	2: 151,938,972	T380M	probably damaging	Het
Apoa5	G	C	9: 46,270,646	R340P	probably damaging	Het
Cyp3a41a	T	A	5: 145,702,198	Y320F	probably damaging	Het
Dmtf1	A	G	5: 9,121,927	L503S	possibly damaging	Het
Dpys	C	G	15: 39,828,071	W285S	probably damaging	Het
Fam187b	T	C	7: 30,977,090	V8A		Het
Fbn2	T	C	18: 58,066,107	E1363G	probably damaging	Het
Glg1	C	T	8: 111,187,793	R453Q	probably benign	Het
Gm5591	T	A	7: 38,520,148	M434L	probably benign	Het
Gm5591	T	C	7: 38,522,256	T130A	probably damaging	Het
Gpld1	G	A	13: 24,979,729	V502I	probably benign	Het
Inhba	A	G	13: 16,017,381	H29R	probably benign	Het
Itga4	T	A	2: 79,325,660	I990N	possibly damaging	Het
Kcnma1	T	A	14: 23,543,077	I280L	probably benign	Het
Malrd1	T	C	2: 15,614,177	V284A		Het
Maml2	C	T	9: 13,621,673	Q728*	probably null	Het
Mkln1	T	C	6: 31,432,970	L181P	probably damaging	Het
Mms22l	T	C	4: 24,580,204		probably null	Het
Muc16	A	G	9: 18,537,764		probably null	Het
Mylk	C	A	16: 34,875,642	S249*	probably null	Het
Naa35	G	A	13: 59,601,003	A150T	possibly damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Nup205	G	A	6: 35,199,974	R635H	probably benign	Het
Olfr263	T	C	13: 21,133,695	F307L	probably benign	Het
Olfr723	T	C	14: 49,929,449	T32A	probably benign	Het
Padi3	T	C	4: 140,810,532	I26V	probably benign	Het
Polq	T	C	16: 37,061,853	S1460P	probably benign	Het
Ptgdr	A	G	14: 44,853,258	S348P		Het
Qsox1	A	G	1: 155,782,597	S409P	probably damaging	Het
Rergl	T	A	6: 139,494,854	Y99F	possibly damaging	Het
Rptn	C	A	3: 93,395,042	H22N	probably benign	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Sh2b1	GGACCAGCTCAG	GGACCAGCTCAGTCACGGTGACCAGCTCAG	7: 126,467,573		probably null	Het
Sh2b1	ACCAGCTCAGCCACGGGG	ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG	7: 126,467,575		probably benign	Het
Slc2a3	A	C	6: 122,736,610	I214M	probably damaging	Het
Slc5a7	A	T	17: 54,276,641	N540K	probably benign	Het
Slco6c1	A	T	1: 97,062,523	S664R	possibly damaging	Het
Tgm4	C	A	9: 123,052,772	S344R	probably damaging	Het
Trim61	T	A	8: 65,014,576	Q11L	probably damaging	Het
Trpm6	C	A	19: 18,832,652	D1137E	possibly damaging	Het
Txndc2	G	A	17: 65,637,997	T395I	probably damaging	Het
Txndc9	T	C	1: 37,995,778	E15G	probably benign	Het
Vcpip1	A	G	1: 9,745,824	I778T	possibly damaging	Het
Zfp383	T	C	7: 29,915,259	F313S	possibly damaging	Het

Other mutations in Dock1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Dock1	APN	7	135146531	splice site	probably benign
IGL01319:Dock1	APN	7	134789278	missense	probably benign
IGL01390:Dock1	APN	7	134745047	missense	possibly damaging	0.95
IGL01394:Dock1	APN	7	134766216	missense	probably benign	0.01
IGL01489:Dock1	APN	7	134999321	splice site	probably benign
IGL01505:Dock1	APN	7	135158510	missense	possibly damaging	0.91
IGL01586:Dock1	APN	7	134753377	missense	probably damaging	1.00
IGL01637:Dock1	APN	7	135137813	critical splice acceptor site	probably null
IGL01649:Dock1	APN	7	134777410	missense	probably damaging	1.00
IGL01652:Dock1	APN	7	134777497	splice site	probably benign
IGL01859:Dock1	APN	7	135077161	missense	possibly damaging	0.51
IGL02068:Dock1	APN	7	134771548	missense	probably benign	0.26
IGL02168:Dock1	APN	7	135077131	splice site	probably benign
IGL02200:Dock1	APN	7	134744271	missense	probably benign	0.01
IGL02244:Dock1	APN	7	134777445	nonsense	probably null
IGL02285:Dock1	APN	7	135081920	critical splice donor site	probably null
IGL02319:Dock1	APN	7	134772449	missense	possibly damaging	0.94
IGL02334:Dock1	APN	7	135145565	missense	probably damaging	1.00
IGL02338:Dock1	APN	7	135133075	missense	possibly damaging	0.95
IGL02351:Dock1	APN	7	135108819	missense	possibly damaging	0.51
IGL02358:Dock1	APN	7	135108819	missense	possibly damaging	0.51
IGL02607:Dock1	APN	7	134851513	missense	probably benign	0.13
IGL02638:Dock1	APN	7	135146480	missense	probably benign	0.09
IGL02724:Dock1	APN	7	135163353	missense	probably benign
IGL02820:Dock1	APN	7	135167215	missense	probably benign	0.11
IGL02950:Dock1	APN	7	134730024	missense	probably damaging	1.00
IGL02993:Dock1	APN	7	134744298	missense	probably benign
IGL03000:Dock1	APN	7	134789240	missense	probably benign	0.17
IGL03092:Dock1	APN	7	134765216	splice site	probably benign
IGL03131:Dock1	APN	7	134874183	missense	possibly damaging	0.80
IGL03136:Dock1	APN	7	135168389	missense	probably benign	0.00
IGL03210:Dock1	APN	7	134756939	missense	possibly damaging	0.62
IGL03220:Dock1	APN	7	135108522	critical splice donor site	probably null
P0028:Dock1	UTSW	7	134999324	splice site	probably benign
PIT4453001:Dock1	UTSW	7	135152300	missense	probably benign
R0003:Dock1	UTSW	7	134730064	splice site	probably benign
R0058:Dock1	UTSW	7	135108761	missense	possibly damaging	0.65
R0058:Dock1	UTSW	7	135108761	missense	possibly damaging	0.65
R0062:Dock1	UTSW	7	134777495	splice site	probably null
R0062:Dock1	UTSW	7	134777495	splice site	probably null
R0179:Dock1	UTSW	7	135098837	missense	probably damaging	0.99
R0180:Dock1	UTSW	7	135098837	missense	probably damaging	0.99
R0347:Dock1	UTSW	7	134763867	missense	probably damaging	1.00
R0399:Dock1	UTSW	7	135163442	missense	probably benign	0.00
R0457:Dock1	UTSW	7	135138145	missense	possibly damaging	0.90
R0480:Dock1	UTSW	7	134737718	missense	probably damaging	1.00
R0521:Dock1	UTSW	7	135143778	missense	probably benign	0.21
R0792:Dock1	UTSW	7	134874150	missense	probably benign	0.02
R1136:Dock1	UTSW	7	134848173	missense	possibly damaging	0.95
R1224:Dock1	UTSW	7	135108819	missense	possibly damaging	0.67
R1267:Dock1	UTSW	7	134746436	missense	probably damaging	1.00
R1373:Dock1	UTSW	7	135167175	missense	probably benign	0.01
R1401:Dock1	UTSW	7	135133936	nonsense	probably null
R1454:Dock1	UTSW	7	134851609	splice site	probably benign
R1465:Dock1	UTSW	7	134782409	missense	probably benign	0.00
R1465:Dock1	UTSW	7	134782409	missense	probably benign	0.00
R1523:Dock1	UTSW	7	134744247	missense	possibly damaging	0.49
R1643:Dock1	UTSW	7	135098779	missense	probably damaging	1.00
R1659:Dock1	UTSW	7	134789243	missense	probably damaging	0.98
R1793:Dock1	UTSW	7	135098727	splice site	probably null
R1864:Dock1	UTSW	7	135146507	missense	probably benign	0.07
R1911:Dock1	UTSW	7	134999300	missense	probably damaging	1.00
R2567:Dock1	UTSW	7	135145484	missense	probably damaging	1.00
R3816:Dock1	UTSW	7	134744286	nonsense	probably null
R3971:Dock1	UTSW	7	134746908	missense	probably damaging	1.00
R4063:Dock1	UTSW	7	135115292	missense	possibly damaging	0.81
R4163:Dock1	UTSW	7	134744322	missense	possibly damaging	0.79
R4271:Dock1	UTSW	7	134734054	missense	probably damaging	0.99
R4684:Dock1	UTSW	7	134724409	nonsense	probably null
R4717:Dock1	UTSW	7	134848170	missense	probably damaging	1.00
R4725:Dock1	UTSW	7	134745014	nonsense	probably null
R4788:Dock1	UTSW	7	135145484	missense	probably damaging	0.98
R4869:Dock1	UTSW	7	134734071	missense	probably damaging	1.00
R4889:Dock1	UTSW	7	134744976	missense	probably benign	0.02
R4953:Dock1	UTSW	7	135152288	missense	probably benign	0.34
R5031:Dock1	UTSW	7	135152246	missense	probably benign	0.02
R5161:Dock1	UTSW	7	134734062	missense	possibly damaging	0.69
R5168:Dock1	UTSW	7	135118908	missense	probably damaging	1.00
R5212:Dock1	UTSW	7	134789194	missense	possibly damaging	0.68
R5648:Dock1	UTSW	7	134746954	missense	probably damaging	1.00
R5685:Dock1	UTSW	7	134772362	missense	probably benign	0.19
R5834:Dock1	UTSW	7	134763933	missense	probably damaging	1.00
R6181:Dock1	UTSW	7	135158522	missense	probably damaging	1.00
R6334:Dock1	UTSW	7	134851576	missense	probably benign	0.01
R6406:Dock1	UTSW	7	135145486	missense	probably benign	0.26
R6425:Dock1	UTSW	7	135163381	missense	possibly damaging	0.79
R6489:Dock1	UTSW	7	134990541	missense	probably damaging	0.99
R6616:Dock1	UTSW	7	135108492	missense	possibly damaging	0.85
R6706:Dock1	UTSW	7	135133886	missense	possibly damaging	0.72
R6766:Dock1	UTSW	7	134756793	splice site	probably null
R6861:Dock1	UTSW	7	134771478	missense	probably benign	0.00
R6985:Dock1	UTSW	7	135163403	missense	possibly damaging	0.95
R7259:Dock1	UTSW	7	134782748	missense	probably damaging	0.99
R7285:Dock1	UTSW	7	134745008	missense	probably benign	0.01
R7471:Dock1	UTSW	7	135163343	missense	possibly damaging	0.65
R7497:Dock1	UTSW	7	134765274	missense	probably benign
R7691:Dock1	UTSW	7	135138157	critical splice donor site	probably null
R7732:Dock1	UTSW	7	134744970	missense	probably benign	0.01
R7818:Dock1	UTSW	7	134763865	missense	probably damaging	1.00
R7918:Dock1	UTSW	7	135145418	missense	probably damaging	1.00
R7960:Dock1	UTSW	7	135077188	missense	possibly damaging	0.83
R7961:Dock1	UTSW	7	134745057	missense	possibly damaging	0.77
R7985:Dock1	UTSW	7	134746954	missense	possibly damaging	0.95
R8009:Dock1	UTSW	7	134745057	missense	possibly damaging	0.77
R8060:Dock1	UTSW	7	135168403	missense	probably benign
R8060:Dock1	UTSW	7	134990629	splice site	probably benign
R8061:Dock1	UTSW	7	134772323	missense	probably benign	0.00
R8101:Dock1	UTSW	7	134999288	missense	possibly damaging	0.89
R8405:Dock1	UTSW	7	134777463	missense	probably benign	0.04
R8508:Dock1	UTSW	7	134782409	missense	probably benign	0.00
R8803:Dock1	UTSW	7	134874087	missense	probably benign	0.28
R9007:Dock1	UTSW	7	134899096	intron	probably benign
R9026:Dock1	UTSW	7	135119017	missense	probably damaging	0.97
R9111:Dock1	UTSW	7	134999288	missense	possibly damaging	0.89
R9359:Dock1	UTSW	7	135168396	missense	probably benign
R9398:Dock1	UTSW	7	135172499	missense	probably damaging	0.99
R9408:Dock1	UTSW	7	135115336	missense	probably damaging	0.99
R9476:Dock1	UTSW	7	134990550	missense	probably benign	0.10
R9478:Dock1	UTSW	7	134766233	missense	probably damaging	1.00
R9510:Dock1	UTSW	7	134990550	missense	probably benign	0.10
R9544:Dock1	UTSW	7	134746457	missense	possibly damaging	0.71
R9605:Dock1	UTSW	7	134782412	missense	possibly damaging	0.49
R9657:Dock1	UTSW	7	134737700	missense	possibly damaging	0.58
R9767:Dock1	UTSW	7	134741067	missense	possibly damaging	0.68
X0062:Dock1	UTSW	7	135108451	missense	probably damaging	1.00
Z1088:Dock1	UTSW	7	134804547	missense	probably damaging	0.98
Z1177:Dock1	UTSW	7	134782400	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACTATGCGGATGCCACTAAGG -3'
(R):5'- CATGCATACCTCAGTCCTGG -3'

Sequencing Primer
(F):5'- CAGAGAGTTGATACGTTGCTTCAAGC -3'
(R):5'- ATACCTCAGTCCTGGCTGCG -3'

Posted On

2022-05-16