Incidental Mutation 'R9403:Trim61'
ID 711349
Institutional Source Beutler Lab
Gene Symbol Trim61
Ensembl Gene ENSMUSG00000109718
Gene Name tripartite motif-containing 61
Synonyms 2czf61, E330039K03Rik, Rnf35
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 65012987-65018523 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65014576 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 11 (Q11L)
Ref Sequence ENSEMBL: ENSMUSP00000077513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048565] [ENSMUST00000078409]
AlphaFold Q8JZK6
Predicted Effect probably benign
Transcript: ENSMUST00000048565
SMART Domains Protein: ENSMUSP00000040299
Gene: ENSMUSG00000053490

DomainStartEndE-ValueType
RING 15 55 1.48e-7 SMART
low complexity region 81 90 N/A INTRINSIC
BBOX 91 132 3.12e-6 SMART
PRY 289 341 4.11e-15 SMART
Pfam:SPRY 344 459 2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078409
AA Change: Q11L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077513
Gene: ENSMUSG00000109718
AA Change: Q11L

DomainStartEndE-ValueType
RING 16 56 4.66e-5 SMART
low complexity region 157 170 N/A INTRINSIC
coiled coil region 201 232 N/A INTRINSIC
PRY 280 331 1.35e-10 SMART
Pfam:SPRY 334 458 5.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211310
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Trim61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Trim61 APN 8 65014091 missense possibly damaging 0.94
R0184:Trim61 UTSW 8 65014417 missense probably benign 0.40
R1955:Trim61 UTSW 8 65013392 missense possibly damaging 0.46
R3928:Trim61 UTSW 8 65013317 missense probably benign 0.39
R3929:Trim61 UTSW 8 65013317 missense probably benign 0.39
R4850:Trim61 UTSW 8 65013418 missense probably damaging 1.00
R6249:Trim61 UTSW 8 65014456 missense probably benign 0.25
R6390:Trim61 UTSW 8 65014190 missense probably benign 0.24
R6406:Trim61 UTSW 8 65013725 missense possibly damaging 0.61
R7159:Trim61 UTSW 8 65013874 missense probably benign 0.19
R7182:Trim61 UTSW 8 65013614 missense probably damaging 0.99
R9359:Trim61 UTSW 8 65014576 missense probably damaging 1.00
X0022:Trim61 UTSW 8 65013313 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAACTCACCTGGTGGCTGATTAC -3'
(R):5'- TGGACTCTGCCATCTGACTC -3'

Sequencing Primer
(F):5'- CACCTGGTGGCTGATTACTCAAAAAG -3'
(R):5'- ATCTGACTCCGGTGCTAAGG -3'
Posted On 2022-05-16