Incidental Mutation 'R9403:Maml2'
ID 711351
Institutional Source Beutler Lab
Gene Symbol Maml2
Ensembl Gene ENSMUSG00000031925
Gene Name mastermind like transcriptional coactivator 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 13297957-13709388 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 13621673 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 728 (Q728*)
Ref Sequence ENSEMBL: ENSMUSP00000124083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034401] [ENSMUST00000159294]
AlphaFold F6U238
Predicted Effect probably benign
Transcript: ENSMUST00000034401
SMART Domains Protein: ENSMUSP00000034401
Gene: ENSMUSG00000031925

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159294
AA Change: Q728*
SMART Domains Protein: ENSMUSP00000124083
Gene: ENSMUSG00000031925
AA Change: Q728*

DomainStartEndE-ValueType
low complexity region 227 245 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
SCOP:d1lsha3 385 459 5e-3 SMART
low complexity region 523 547 N/A INTRINSIC
low complexity region 571 589 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
low complexity region 734 753 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Maml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Maml2 APN 9 13621604 unclassified probably benign
IGL00424:Maml2 APN 9 13620912 missense probably damaging 0.99
IGL02711:Maml2 APN 9 13620063 missense probably benign 0.14
IGL03079:Maml2 APN 9 13621616 unclassified probably benign
IGL03217:Maml2 APN 9 13619999 missense probably damaging 1.00
FR4304:Maml2 UTSW 9 13621459 small deletion probably benign
FR4449:Maml2 UTSW 9 13621456 small deletion probably benign
PIT4810001:Maml2 UTSW 9 13620024 missense
R0102:Maml2 UTSW 9 13705932 synonymous silent
R0318:Maml2 UTSW 9 13620594 missense probably damaging 0.99
R0380:Maml2 UTSW 9 13621100 nonsense probably null
R1433:Maml2 UTSW 9 13706501 missense probably damaging 1.00
R1449:Maml2 UTSW 9 13620684 missense possibly damaging 0.85
R1789:Maml2 UTSW 9 13697345 missense probably damaging 1.00
R2173:Maml2 UTSW 9 13621616 unclassified probably benign
R2363:Maml2 UTSW 9 13621245 missense probably damaging 1.00
R2426:Maml2 UTSW 9 13706498 missense probably damaging 1.00
R2880:Maml2 UTSW 9 13620597 splice site probably null
R3981:Maml2 UTSW 9 13621068 missense possibly damaging 0.80
R4094:Maml2 UTSW 9 13620153 missense probably benign 0.22
R4117:Maml2 UTSW 9 13705934 missense probably damaging 1.00
R4282:Maml2 UTSW 9 13620110 missense possibly damaging 0.93
R4618:Maml2 UTSW 9 13620075 missense probably damaging 1.00
R4921:Maml2 UTSW 9 13621175 missense probably damaging 1.00
R4957:Maml2 UTSW 9 13620276 missense probably damaging 1.00
R5195:Maml2 UTSW 9 13621114 missense probably damaging 0.98
R5428:Maml2 UTSW 9 13705895 missense probably benign 0.30
R5448:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5450:Maml2 UTSW 9 13706467 missense probably damaging 0.98
R5455:Maml2 UTSW 9 13705743 nonsense probably null
R5620:Maml2 UTSW 9 13697320 missense probably damaging 1.00
R5973:Maml2 UTSW 9 13621619 unclassified probably benign
R6009:Maml2 UTSW 9 13620998 missense probably benign 0.02
R6054:Maml2 UTSW 9 13621399 small deletion probably benign
R6257:Maml2 UTSW 9 13620426 missense probably damaging 1.00
R6727:Maml2 UTSW 9 13621551 unclassified probably benign
R6824:Maml2 UTSW 9 13697217 missense possibly damaging 0.67
R6854:Maml2 UTSW 9 13705835 missense possibly damaging 0.59
R6998:Maml2 UTSW 9 13621185 unclassified probably benign
R7047:Maml2 UTSW 9 13620881 unclassified probably benign
R7233:Maml2 UTSW 9 13620771 missense
R7326:Maml2 UTSW 9 13621607 missense
R7612:Maml2 UTSW 9 13706485 missense probably benign 0.04
R7652:Maml2 UTSW 9 13621649 missense
R7699:Maml2 UTSW 9 13621089 missense
R7700:Maml2 UTSW 9 13621089 missense
R7803:Maml2 UTSW 9 13621254 small insertion probably benign
R7803:Maml2 UTSW 9 13621275 small insertion probably benign
R7803:Maml2 UTSW 9 13621276 small insertion probably benign
R8425:Maml2 UTSW 9 13620117 missense
R8810:Maml2 UTSW 9 13621622 missense
R9277:Maml2 UTSW 9 13620576 missense
R9359:Maml2 UTSW 9 13621673 nonsense probably null
RF015:Maml2 UTSW 9 13621456 small deletion probably benign
RF044:Maml2 UTSW 9 13621456 small deletion probably benign
X0063:Maml2 UTSW 9 13620341 missense probably benign 0.09
Z1177:Maml2 UTSW 9 13706590 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTGCCTTCCCAGAGCAAAC -3'
(R):5'- TCACTGATCATTACAGATCCCC -3'

Sequencing Primer
(F):5'- AGGTTCATTGACAGCTCAGC -3'
(R):5'- TGATCATTACAGATCCCCCAAGC -3'
Posted On 2022-05-16