Incidental Mutation 'R9403:Tgm4'
ID 711354
Institutional Source Beutler Lab
Gene Symbol Tgm4
Ensembl Gene ENSMUSG00000025787
Gene Name transglutaminase 4 (prostate)
Synonyms 9530008N10Rik, Eapa1, experimental autoimmune prostatitis antigen 1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 123034726-123067561 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 123052772 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 344 (S344R)
Ref Sequence ENSEMBL: ENSMUSP00000026893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000215247] [ENSMUST00000217607]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026893
AA Change: S344R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787
AA Change: S344R

DomainStartEndE-ValueType
Pfam:Transglut_N 8 118 4e-26 PFAM
TGc 247 340 6.25e-42 SMART
Pfam:Transglut_C 573 670 3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215247
Predicted Effect probably benign
Transcript: ENSMUST00000217607
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Tgm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tgm4 APN 9 123062382 unclassified probably benign
IGL01402:Tgm4 APN 9 123051454 missense possibly damaging 0.82
IGL02000:Tgm4 APN 9 123056466 missense probably damaging 1.00
IGL02120:Tgm4 APN 9 123046529 missense probably damaging 0.98
IGL03130:Tgm4 APN 9 123056515 missense probably damaging 1.00
IGL03188:Tgm4 APN 9 123045036 missense probably null 0.06
R0329:Tgm4 UTSW 9 123048557 critical splice donor site probably null
R0480:Tgm4 UTSW 9 123062419 missense probably benign
R0644:Tgm4 UTSW 9 123051458 missense probably damaging 1.00
R0990:Tgm4 UTSW 9 123046511 missense probably benign 0.02
R1604:Tgm4 UTSW 9 123045064 missense probably benign 0.39
R1644:Tgm4 UTSW 9 123051416 missense probably damaging 1.00
R2056:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2058:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2059:Tgm4 UTSW 9 123061770 missense probably damaging 1.00
R2076:Tgm4 UTSW 9 123051095 missense probably benign 0.24
R2437:Tgm4 UTSW 9 123048549 nonsense probably null
R4392:Tgm4 UTSW 9 123066752 missense probably benign 0.10
R4407:Tgm4 UTSW 9 123056530 missense probably damaging 1.00
R4752:Tgm4 UTSW 9 123051386 missense probably damaging 1.00
R5288:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5365:Tgm4 UTSW 9 123066801 missense probably damaging 1.00
R5386:Tgm4 UTSW 9 123056494 missense probably damaging 1.00
R5790:Tgm4 UTSW 9 123061743 missense probably damaging 0.98
R5890:Tgm4 UTSW 9 123061638 missense probably damaging 1.00
R6102:Tgm4 UTSW 9 123056535 missense probably benign
R6358:Tgm4 UTSW 9 123056518 missense probably damaging 1.00
R6956:Tgm4 UTSW 9 123064703 missense possibly damaging 0.93
R6966:Tgm4 UTSW 9 123051142 missense possibly damaging 0.68
R7091:Tgm4 UTSW 9 123040460 missense probably damaging 1.00
R7258:Tgm4 UTSW 9 123062491 missense probably benign 0.02
R7313:Tgm4 UTSW 9 123062491 missense probably benign 0.02
R7369:Tgm4 UTSW 9 123056684 critical splice donor site probably null
R7802:Tgm4 UTSW 9 123051336 intron probably benign
R8219:Tgm4 UTSW 9 123045052 missense probably benign
R8787:Tgm4 UTSW 9 123061845 missense probably damaging 1.00
R8936:Tgm4 UTSW 9 123040476 missense possibly damaging 0.92
R9045:Tgm4 UTSW 9 123048551 missense possibly damaging 0.94
R9328:Tgm4 UTSW 9 123056632 missense possibly damaging 0.93
R9359:Tgm4 UTSW 9 123052772 missense probably damaging 1.00
R9471:Tgm4 UTSW 9 123040379 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTGACAAGGGTTCCCACC -3'
(R):5'- CGTTTGAAAATGTGAGTTGTACCTCC -3'

Sequencing Primer
(F):5'- CTTCAGAACAACCTTAGAGGGCTATG -3'
(R):5'- GAAAATGTGAGTTGTACCTCCCTTCC -3'
Posted On 2022-05-16