Incidental Mutation 'R9403:Inhba'
ID 711356
Institutional Source Beutler Lab
Gene Symbol Inhba
Ensembl Gene ENSMUSG00000041324
Gene Name inhibin beta-A
Synonyms activin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 16011851-16031621 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16017381 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 29 (H29R)
Ref Sequence ENSEMBL: ENSMUSP00000047894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042603] [ENSMUST00000164993]
AlphaFold Q04998
Predicted Effect probably benign
Transcript: ENSMUST00000042603
AA Change: H29R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000047894
Gene: ENSMUSG00000041324
AA Change: H29R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TGFb_propeptide 37 294 9.5e-20 PFAM
TGFB 319 424 1.3e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164993
AA Change: H29R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000132085
Gene: ENSMUSG00000041324
AA Change: H29R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TGFb_propeptide 45 293 3.8e-12 PFAM
TGFB 319 424 1.3e-58 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes. These complexes activate and inhibit, respectively, follicle stimulating hormone secretion from the pituitary gland. The encoded protein also plays a role in eye, tooth and testis development. Homozygous knockout mice for this gene lack whiskers and exhibit tooth and palate defects, leading to neonatal lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a targeted null mutation lack vibrissae and lower incisors, have defects in their secondary palates, and die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Inhba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Inhba APN 13 16026972 missense probably benign 0.00
IGL02666:Inhba APN 13 16027079 missense possibly damaging 0.87
IGL03138:Inhba UTSW 13 16017514 missense probably benign
R0020:Inhba UTSW 13 16026364 missense possibly damaging 0.46
R0591:Inhba UTSW 13 16026820 missense probably damaging 1.00
R1510:Inhba UTSW 13 16027022 missense probably damaging 0.99
R1667:Inhba UTSW 13 16026624 missense possibly damaging 0.90
R1966:Inhba UTSW 13 16026636 missense probably damaging 1.00
R4710:Inhba UTSW 13 16026483 missense probably benign
R4893:Inhba UTSW 13 16026549 missense possibly damaging 0.61
R5472:Inhba UTSW 13 16026786 missense probably damaging 0.99
R5905:Inhba UTSW 13 16017308 missense probably benign 0.05
R7555:Inhba UTSW 13 16017637 missense probably benign 0.28
R7965:Inhba UTSW 13 16026987 missense possibly damaging 0.75
R8031:Inhba UTSW 13 16026275 missense possibly damaging 0.86
R8997:Inhba UTSW 13 16026522 missense possibly damaging 0.94
R9004:Inhba UTSW 13 16026941 missense probably benign 0.05
R9359:Inhba UTSW 13 16017381 missense probably benign 0.01
R9474:Inhba UTSW 13 16017678 missense probably benign 0.03
R9505:Inhba UTSW 13 16026771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTGTTCCAGAGAATTTGC -3'
(R):5'- ATGAAGCTTTCTGATCGCGTTG -3'

Sequencing Primer
(F):5'- CTTGTTCCAGAGAATTTGCTGAAGAG -3'
(R):5'- TCTGATCGCGTTGAGAAGC -3'
Posted On 2022-05-16