Mutagenetix > Incidental Mutation

Incidental Mutation 'R9403:Gpld1'

711358

Institutional Source

Beutler Lab

Gene Symbol

Gpld1

Ensembl Gene

ENSMUSG00000021340

Gene Name

glycosylphosphatidylinositol specific phospholipase D1

Synonyms

6330541J12Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9403 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24943152-24992501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 24979729 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 502 (V502I)

Ref Sequence

ENSEMBL: ENSMUSP00000021773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021773]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000021773
AA Change: V502I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000021773
Gene: ENSMUSG00000021340
AA Change: V502I

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Zn_dep_PLPC	28	219	9.8e-28	PFAM
Int_alpha	377	435	7.21e-11	SMART
Int_alpha	446	503	7.43e-13	SMART
Int_alpha	509	565	7.86e-3	SMART
Int_alpha	576	643	4.09e0	SMART
Blast:Int_alpha	644	708	2e-24	BLAST
Int_alpha	716	774	1.86e-4	SMART
Blast:Int_alpha	789	837	1e-16	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	T	G	6: 96,165,299	T255P	probably benign	Het
4930444G20Rik	C	T	10: 22,067,941	D47N	possibly damaging	Het
Angpt4	C	T	2: 151,938,972	T380M	probably damaging	Het
Apoa5	G	C	9: 46,270,646	R340P	probably damaging	Het
Cyp3a41a	T	A	5: 145,702,198	Y320F	probably damaging	Het
Dmtf1	A	G	5: 9,121,927	L503S	possibly damaging	Het
Dock1	T	C	7: 135,168,396	V1795A	probably benign	Het
Dpys	C	G	15: 39,828,071	W285S	probably damaging	Het
Fam187b	T	C	7: 30,977,090	V8A		Het
Fbn2	T	C	18: 58,066,107	E1363G	probably damaging	Het
Glg1	C	T	8: 111,187,793	R453Q	probably benign	Het
Gm5591	T	A	7: 38,520,148	M434L	probably benign	Het
Gm5591	T	C	7: 38,522,256	T130A	probably damaging	Het
Inhba	A	G	13: 16,017,381	H29R	probably benign	Het
Itga4	T	A	2: 79,325,660	I990N	possibly damaging	Het
Kcnma1	T	A	14: 23,543,077	I280L	probably benign	Het
Malrd1	T	C	2: 15,614,177	V284A		Het
Maml2	C	T	9: 13,621,673	Q728*	probably null	Het
Mkln1	T	C	6: 31,432,970	L181P	probably damaging	Het
Mms22l	T	C	4: 24,580,204		probably null	Het
Muc16	A	G	9: 18,537,764		probably null	Het
Mylk	C	A	16: 34,875,642	S249*	probably null	Het
Naa35	G	A	13: 59,601,003	A150T	possibly damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Nup205	G	A	6: 35,199,974	R635H	probably benign	Het
Olfr263	T	C	13: 21,133,695	F307L	probably benign	Het
Olfr723	T	C	14: 49,929,449	T32A	probably benign	Het
Padi3	T	C	4: 140,810,532	I26V	probably benign	Het
Polq	T	C	16: 37,061,853	S1460P	probably benign	Het
Ptgdr	A	G	14: 44,853,258	S348P		Het
Qsox1	A	G	1: 155,782,597	S409P	probably damaging	Het
Rergl	T	A	6: 139,494,854	Y99F	possibly damaging	Het
Rptn	C	A	3: 93,395,042	H22N	probably benign	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Sh2b1	GGACCAGCTCAG	GGACCAGCTCAGTCACGGTGACCAGCTCAG	7: 126,467,573		probably null	Het
Sh2b1	ACCAGCTCAGCCACGGGG	ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG	7: 126,467,575		probably benign	Het
Slc2a3	A	C	6: 122,736,610	I214M	probably damaging	Het
Slc5a7	A	T	17: 54,276,641	N540K	probably benign	Het
Slco6c1	A	T	1: 97,062,523	S664R	possibly damaging	Het
Tgm4	C	A	9: 123,052,772	S344R	probably damaging	Het
Trim61	T	A	8: 65,014,576	Q11L	probably damaging	Het
Trpm6	C	A	19: 18,832,652	D1137E	possibly damaging	Het
Txndc2	G	A	17: 65,637,997	T395I	probably damaging	Het
Txndc9	T	C	1: 37,995,778	E15G	probably benign	Het
Vcpip1	A	G	1: 9,745,824	I778T	possibly damaging	Het
Zfp383	T	C	7: 29,915,259	F313S	possibly damaging	Het

Other mutations in Gpld1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Gpld1	APN	13	24986922	splice site	probably benign
IGL00886:Gpld1	APN	13	24962353	nonsense	probably null
IGL01060:Gpld1	APN	13	24982566	missense	probably damaging	1.00
IGL01450:Gpld1	APN	13	24979681	missense	probably damaging	1.00
IGL02176:Gpld1	APN	13	24984209	critical splice donor site	probably null
IGL02288:Gpld1	APN	13	24979683	nonsense	probably null
IGL02323:Gpld1	APN	13	24982774	missense	probably damaging	0.97
IGL02588:Gpld1	APN	13	24943699	missense	probably damaging	1.00
IGL02832:Gpld1	APN	13	24952878	missense	probably damaging	1.00
IGL02989:Gpld1	APN	13	24990036	missense	possibly damaging	0.87
IGL03282:Gpld1	APN	13	24971408	missense	probably benign	0.01
IGL03345:Gpld1	APN	13	24987024	missense	probably damaging	1.00
R0017:Gpld1	UTSW	13	24990118	missense	probably damaging	1.00
R0017:Gpld1	UTSW	13	24990118	missense	probably damaging	1.00
R0308:Gpld1	UTSW	13	24962835	missense	possibly damaging	0.81
R0441:Gpld1	UTSW	13	24962320	nonsense	probably null
R1172:Gpld1	UTSW	13	24957566	splice site	probably null
R1411:Gpld1	UTSW	13	24962808	missense	probably damaging	0.99
R1502:Gpld1	UTSW	13	24971416	missense	probably benign	0.00
R1565:Gpld1	UTSW	13	24956068	missense	probably damaging	0.99
R1931:Gpld1	UTSW	13	24943710	missense	possibly damaging	0.71
R1999:Gpld1	UTSW	13	24962647	missense	probably benign	0.23
R2150:Gpld1	UTSW	13	24962647	missense	probably benign	0.23
R2240:Gpld1	UTSW	13	24982507	critical splice acceptor site	probably null
R2327:Gpld1	UTSW	13	24984821	missense	probably benign	0.00
R2373:Gpld1	UTSW	13	24962856	missense	probably benign	0.26
R3153:Gpld1	UTSW	13	24943620	missense	unknown
R3154:Gpld1	UTSW	13	24943620	missense	unknown
R3154:Gpld1	UTSW	13	24956163	critical splice donor site	probably null
R3911:Gpld1	UTSW	13	24962322	missense	probably damaging	1.00
R4616:Gpld1	UTSW	13	24984816	missense	probably damaging	1.00
R4660:Gpld1	UTSW	13	24982603	splice site	probably null
R4755:Gpld1	UTSW	13	24979688	missense	probably benign	0.13
R4755:Gpld1	UTSW	13	24979692	nonsense	probably null
R4835:Gpld1	UTSW	13	24982716	missense	probably benign	0.00
R4895:Gpld1	UTSW	13	24979728	missense	probably damaging	0.97
R5050:Gpld1	UTSW	13	24962756	missense	probably benign	0.00
R5182:Gpld1	UTSW	13	24984070	splice site	probably null
R6161:Gpld1	UTSW	13	24971414	missense	probably benign	0.00
R6626:Gpld1	UTSW	13	24979970	missense	probably damaging	1.00
R7021:Gpld1	UTSW	13	24984708	missense	probably damaging	1.00
R7577:Gpld1	UTSW	13	24962405	missense	probably benign	0.05
R7583:Gpld1	UTSW	13	24975760	missense	probably damaging	1.00
R7659:Gpld1	UTSW	13	24979981	missense	probably benign	0.00
R7737:Gpld1	UTSW	13	24975726	missense	probably damaging	1.00
R7738:Gpld1	UTSW	13	24962322	missense	probably damaging	1.00
R7752:Gpld1	UTSW	13	24962775	missense	probably damaging	1.00
R7759:Gpld1	UTSW	13	24962400	missense	probably damaging	0.99
R7901:Gpld1	UTSW	13	24962775	missense	probably damaging	1.00
R8855:Gpld1	UTSW	13	24986907	missense	probably benign	0.00
R8866:Gpld1	UTSW	13	24986907	missense	probably benign	0.00
R9150:Gpld1	UTSW	13	24962322	missense	probably damaging	1.00
R9228:Gpld1	UTSW	13	24952917	missense	probably damaging	1.00
R9359:Gpld1	UTSW	13	24979729	missense	probably benign	0.00
X0024:Gpld1	UTSW	13	24982596	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGCCAGTTTCCAGACTGTG -3'
(R):5'- AGGTGGCCACAATTCCTCTC -3'

Sequencing Primer
(F):5'- GCCAGTTTCCAGACTGTGTTTCTG -3'
(R):5'- AGCTGATGACCAGATCGTGC -3'

Posted On

2022-05-16