Incidental Mutation 'R9403:Naa35'
ID 711359
Institutional Source Beutler Lab
Gene Symbol Naa35
Ensembl Gene ENSMUSG00000021555
Gene Name N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Synonyms Mak10, A330021G12Rik, C030004C14Rik, A330027C19Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 59585259-59635922 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 59601003 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 150 (A150T)
Ref Sequence ENSEMBL: ENSMUSP00000022038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022038] [ENSMUST00000164011] [ENSMUST00000166923] [ENSMUST00000168367] [ENSMUST00000172419]
AlphaFold Q6PHQ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000022038
AA Change: A150T

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022038
Gene: ENSMUSG00000021555
AA Change: A150T

DomainStartEndE-ValueType
Pfam:Mak10 45 145 2.2e-29 PFAM
Pfam:Mak10 141 194 3.7e-10 PFAM
low complexity region 561 568 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164011
AA Change: A72T

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127270
Gene: ENSMUSG00000021555
AA Change: A72T

DomainStartEndE-ValueType
Pfam:Mak10 1 119 1.9e-37 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000128097
Gene: ENSMUSG00000021555
AA Change: A150T

DomainStartEndE-ValueType
Pfam:Mak10 44 188 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168367
SMART Domains Protein: ENSMUSP00000127466
Gene: ENSMUSG00000021555

DomainStartEndE-ValueType
Pfam:Mak10 44 111 3.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172419
AA Change: A146T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126079
Gene: ENSMUSG00000021555
AA Change: A146T

DomainStartEndE-ValueType
Pfam:Mak10 40 193 1.2e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Naa35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Naa35 APN 13 59630055 missense probably damaging 1.00
IGL00743:Naa35 APN 13 59630671 missense probably benign 0.33
IGL01335:Naa35 APN 13 59616796 missense probably damaging 1.00
IGL01385:Naa35 APN 13 59601066 missense probably damaging 1.00
IGL01541:Naa35 APN 13 59600963 missense probably damaging 1.00
IGL02129:Naa35 APN 13 59609525 missense probably damaging 0.99
IGL02867:Naa35 APN 13 59608854 intron probably benign
IGL02966:Naa35 APN 13 59586271 missense probably benign
IGL03260:Naa35 APN 13 59627885 missense probably benign 0.05
R0312:Naa35 UTSW 13 59609581 missense probably benign 0.01
R0557:Naa35 UTSW 13 59627964 missense probably damaging 0.99
R1553:Naa35 UTSW 13 59618279 critical splice donor site probably null
R1611:Naa35 UTSW 13 59628933 missense probably benign 0.01
R1676:Naa35 UTSW 13 59612676 missense probably damaging 1.00
R3709:Naa35 UTSW 13 59618032 splice site probably benign
R3896:Naa35 UTSW 13 59607295 missense probably damaging 1.00
R5001:Naa35 UTSW 13 59625531 missense possibly damaging 0.75
R5647:Naa35 UTSW 13 59622866 unclassified probably benign
R5649:Naa35 UTSW 13 59622866 unclassified probably benign
R5650:Naa35 UTSW 13 59622866 unclassified probably benign
R5656:Naa35 UTSW 13 59622866 unclassified probably benign
R6734:Naa35 UTSW 13 59608191 missense possibly damaging 0.83
R6735:Naa35 UTSW 13 59625564 missense probably damaging 1.00
R6985:Naa35 UTSW 13 59627943 missense probably benign 0.03
R7165:Naa35 UTSW 13 59586183 missense probably benign 0.05
R7531:Naa35 UTSW 13 59617941 nonsense probably null
R7713:Naa35 UTSW 13 59598105 missense probably benign 0.01
R7739:Naa35 UTSW 13 59599784 missense probably damaging 1.00
R8685:Naa35 UTSW 13 59586222 missense probably benign 0.43
R8818:Naa35 UTSW 13 59600947 missense probably damaging 1.00
R8838:Naa35 UTSW 13 59627961 missense probably benign
R9006:Naa35 UTSW 13 59601028 missense possibly damaging 0.68
R9132:Naa35 UTSW 13 59624527 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCCTGACTTGTGTGAGCTCC -3'
(R):5'- TTGAACTGCAGACACGTGC -3'

Sequencing Primer
(F):5'- GTGAGCTCCTTTTTAACGGTC -3'
(R):5'- GTGCCACACATGACCAAGG -3'
Posted On 2022-05-16