Incidental Mutation 'R9403:Ptgdr'
ID 711362
Institutional Source Beutler Lab
Gene Symbol Ptgdr
Ensembl Gene ENSMUSG00000071489
Gene Name prostaglandin D receptor
Synonyms DP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 44851235-44859375 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44853258 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 348 (S348P)
Ref Sequence ENSEMBL: ENSMUSP00000093653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095959]
AlphaFold P70263
Predicted Effect
SMART Domains Protein: ENSMUSP00000093653
Gene: ENSMUSG00000071489
AA Change: S348P

DomainStartEndE-ValueType
low complexity region 22 46 N/A INTRINSIC
Pfam:7tm_1 54 319 1.1e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein is reported to be a receptor for prostaglandin D2, which is a mediator of allergic inflammation and allergic airway inflammation in asthma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a reduced inflammatory response to airborn allergens and reduced susceptibility to passive cutaneous anaphylaxis induced by IgE antigen challenge due to impaired mast cell degranulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Ptgdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02548:Ptgdr APN 14 44858614 missense probably damaging 1.00
R1036:Ptgdr UTSW 14 44859115 missense probably damaging 0.98
R1368:Ptgdr UTSW 14 44853342 missense probably damaging 1.00
R1649:Ptgdr UTSW 14 44858502 missense probably benign
R1785:Ptgdr UTSW 14 44858579 nonsense probably null
R1786:Ptgdr UTSW 14 44858579 nonsense probably null
R1921:Ptgdr UTSW 14 44853281 missense probably benign 0.00
R2312:Ptgdr UTSW 14 44859162 missense probably damaging 1.00
R4867:Ptgdr UTSW 14 44858796 missense probably damaging 1.00
R5198:Ptgdr UTSW 14 44858843 missense probably damaging 1.00
R6917:Ptgdr UTSW 14 44858610 missense possibly damaging 0.81
R7186:Ptgdr UTSW 14 44858944 missense probably damaging 1.00
R7291:Ptgdr UTSW 14 44859192 missense possibly damaging 0.69
R7399:Ptgdr UTSW 14 44858232 splice site probably null
R7612:Ptgdr UTSW 14 44858637 missense probably damaging 0.98
R7763:Ptgdr UTSW 14 44859078 missense probably damaging 0.99
R7850:Ptgdr UTSW 14 44853371 missense probably benign 0.05
R8139:Ptgdr UTSW 14 44858685 missense probably benign 0.13
R8262:Ptgdr UTSW 14 44853401 missense probably benign 0.01
R8392:Ptgdr UTSW 14 44858922 missense probably damaging 1.00
R8992:Ptgdr UTSW 14 44858724 missense probably damaging 1.00
R9359:Ptgdr UTSW 14 44853258 missense
Predicted Primers PCR Primer
(F):5'- CCATCAGGTACAAATGTTGAGAC -3'
(R):5'- GCCTTTAAACTTGAGAACAAAGCTG -3'

Sequencing Primer
(F):5'- GTTCTGGGAATCAAACTCAGGTCC -3'
(R):5'- CTGAAGGAGACTCAGAAGACCTC -3'
Posted On 2022-05-16