Incidental Mutation 'R9403:Olfr723'
ID 711363
Institutional Source Beutler Lab
Gene Symbol Olfr723
Ensembl Gene ENSMUSG00000093825
Gene Name olfactory receptor 723
Synonyms GA_x6K02T2PMLR-5600424-5599495, MOR247-4, MOR247-3P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 49928563-49931787 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 49929449 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 32 (T32A)
Ref Sequence ENSEMBL: ENSMUSP00000145863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164157] [ENSMUST00000206058]
AlphaFold E9PZU2
Predicted Effect probably benign
Transcript: ENSMUST00000164157
AA Change: T32A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129254
Gene: ENSMUSG00000093825
AA Change: T32A

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.8e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 302 1.4e-12 PFAM
Pfam:7tm_1 41 287 4.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206058
AA Change: T32A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Dpys C G 15: 39,828,071 W285S probably damaging Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Olfr723
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01968:Olfr723 APN 14 49929098 missense probably damaging 1.00
IGL02481:Olfr723 APN 14 49928707 missense probably damaging 1.00
IGL03269:Olfr723 APN 14 49928708 missense probably damaging 1.00
IGL03330:Olfr723 APN 14 49929221 missense probably damaging 1.00
R1782:Olfr723 UTSW 14 49928639 missense probably benign
R2061:Olfr723 UTSW 14 49929021 missense possibly damaging 0.78
R3014:Olfr723 UTSW 14 49929032 missense probably benign 0.00
R4134:Olfr723 UTSW 14 49928815 missense probably damaging 1.00
R4135:Olfr723 UTSW 14 49928815 missense probably damaging 1.00
R4212:Olfr723 UTSW 14 49928889 nonsense probably null
R4774:Olfr723 UTSW 14 49929269 missense probably damaging 1.00
R4951:Olfr723 UTSW 14 49929058 nonsense probably null
R4965:Olfr723 UTSW 14 49928897 missense probably benign 0.01
R5254:Olfr723 UTSW 14 49928779 missense probably damaging 0.99
R5306:Olfr723 UTSW 14 49929550 start gained probably benign
R5502:Olfr723 UTSW 14 49929536 missense probably benign
R5799:Olfr723 UTSW 14 49929040 missense probably damaging 1.00
R6062:Olfr723 UTSW 14 49928662 missense probably damaging 1.00
R6072:Olfr723 UTSW 14 49929149 missense probably damaging 1.00
R7816:Olfr723 UTSW 14 49929165 missense probably damaging 1.00
R9359:Olfr723 UTSW 14 49929449 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGAACATCTGGGCCATGC -3'
(R):5'- CCTTATATGCTGGATGTGATATGATGC -3'

Sequencing Primer
(F):5'- GCAGCCCTGAAAAGAGATGCTC -3'
(R):5'- TTCAAGCTATGCTCTGATATGTTG -3'
Posted On 2022-05-16