Incidental Mutation 'R9403:Or4l1'
ID 711363
Institutional Source Beutler Lab
Gene Symbol Or4l1
Ensembl Gene ENSMUSG00000093825
Gene Name olfactory receptor family 4 subfamily L member 1
Synonyms GA_x6K02T2PMLR-5600424-5599495, Olfr723, MOR247-3P, MOR247-4
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 50166020-50167025 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50166906 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 32 (T32A)
Ref Sequence ENSEMBL: ENSMUSP00000145863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164157] [ENSMUST00000206058]
AlphaFold E9PZU2
Predicted Effect probably benign
Transcript: ENSMUST00000164157
AA Change: T32A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129254
Gene: ENSMUSG00000093825
AA Change: T32A

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.8e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 302 1.4e-12 PFAM
Pfam:7tm_1 41 287 4.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206058
AA Change: T32A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt4 C T 2: 151,780,892 (GRCm39) T380M probably damaging Het
Apoa5 G C 9: 46,181,944 (GRCm39) R340P probably damaging Het
Cyp3a41a T A 5: 145,639,008 (GRCm39) Y320F probably damaging Het
Dmtf1 A G 5: 9,171,927 (GRCm39) L503S possibly damaging Het
Dock1 T C 7: 134,770,125 (GRCm39) V1795A probably benign Het
Dpys C G 15: 39,691,467 (GRCm39) W285S probably damaging Het
Fam187b T C 7: 30,676,515 (GRCm39) V8A Het
Fbn2 T C 18: 58,199,179 (GRCm39) E1363G probably damaging Het
Glg1 C T 8: 111,914,425 (GRCm39) R453Q probably benign Het
Gm5591 T C 7: 38,221,680 (GRCm39) T130A probably damaging Het
Gm5591 T A 7: 38,219,572 (GRCm39) M434L probably benign Het
Gpld1 G A 13: 25,163,712 (GRCm39) V502I probably benign Het
Inhba A G 13: 16,191,966 (GRCm39) H29R probably benign Het
Itga4 T A 2: 79,156,004 (GRCm39) I990N possibly damaging Het
Kcnma1 T A 14: 23,593,145 (GRCm39) I280L probably benign Het
Malrd1 T C 2: 15,618,988 (GRCm39) V284A Het
Maml2 C T 9: 13,532,969 (GRCm39) Q728* probably null Het
Mkln1 T C 6: 31,409,905 (GRCm39) L181P probably damaging Het
Mms22l T C 4: 24,580,204 (GRCm39) probably null Het
Muc16 A G 9: 18,449,060 (GRCm39) probably null Het
Mylk C A 16: 34,696,012 (GRCm39) S249* probably null Het
Naa35 G A 13: 59,748,817 (GRCm39) A150T possibly damaging Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Nup205 G A 6: 35,176,909 (GRCm39) R635H probably benign Het
Nup50l T G 6: 96,142,280 (GRCm39) T255P probably benign Het
Or2w1 T C 13: 21,317,865 (GRCm39) F307L probably benign Het
Padi3 T C 4: 140,537,843 (GRCm39) I26V probably benign Het
Polq T C 16: 36,882,215 (GRCm39) S1460P probably benign Het
Ptgdr A G 14: 45,090,715 (GRCm39) S348P Het
Qsox1 A G 1: 155,658,343 (GRCm39) S409P probably damaging Het
Rergl T A 6: 139,471,852 (GRCm39) Y99F possibly damaging Het
Rptn C A 3: 93,302,349 (GRCm39) H22N probably benign Het
Semp2l2b C T 10: 21,943,840 (GRCm39) D47N possibly damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,066,745 (GRCm39) probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,066,747 (GRCm39) probably benign Het
Slc2a3 A C 6: 122,713,569 (GRCm39) I214M probably damaging Het
Slc5a7 A T 17: 54,583,669 (GRCm39) N540K probably benign Het
Slco6c1 A T 1: 96,990,248 (GRCm39) S664R possibly damaging Het
Tgm4 C A 9: 122,881,837 (GRCm39) S344R probably damaging Het
Trim61 T A 8: 65,467,228 (GRCm39) Q11L probably damaging Het
Trpm6 C A 19: 18,810,016 (GRCm39) D1137E possibly damaging Het
Txndc2 G A 17: 65,944,992 (GRCm39) T395I probably damaging Het
Txndc9 T C 1: 38,034,859 (GRCm39) E15G probably benign Het
Vcpip1 A G 1: 9,816,049 (GRCm39) I778T possibly damaging Het
Zfp383 T C 7: 29,614,684 (GRCm39) F313S possibly damaging Het
Other mutations in Or4l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01968:Or4l1 APN 14 50,166,555 (GRCm39) missense probably damaging 1.00
IGL02481:Or4l1 APN 14 50,166,164 (GRCm39) missense probably damaging 1.00
IGL03269:Or4l1 APN 14 50,166,165 (GRCm39) missense probably damaging 1.00
IGL03330:Or4l1 APN 14 50,166,678 (GRCm39) missense probably damaging 1.00
R1782:Or4l1 UTSW 14 50,166,096 (GRCm39) missense probably benign
R2061:Or4l1 UTSW 14 50,166,478 (GRCm39) missense possibly damaging 0.78
R3014:Or4l1 UTSW 14 50,166,489 (GRCm39) missense probably benign 0.00
R4134:Or4l1 UTSW 14 50,166,272 (GRCm39) missense probably damaging 1.00
R4135:Or4l1 UTSW 14 50,166,272 (GRCm39) missense probably damaging 1.00
R4212:Or4l1 UTSW 14 50,166,346 (GRCm39) nonsense probably null
R4774:Or4l1 UTSW 14 50,166,726 (GRCm39) missense probably damaging 1.00
R4951:Or4l1 UTSW 14 50,166,515 (GRCm39) nonsense probably null
R4965:Or4l1 UTSW 14 50,166,354 (GRCm39) missense probably benign 0.01
R5254:Or4l1 UTSW 14 50,166,236 (GRCm39) missense probably damaging 0.99
R5306:Or4l1 UTSW 14 50,167,007 (GRCm39) start gained probably benign
R5502:Or4l1 UTSW 14 50,166,993 (GRCm39) missense probably benign
R5799:Or4l1 UTSW 14 50,166,497 (GRCm39) missense probably damaging 1.00
R6062:Or4l1 UTSW 14 50,166,119 (GRCm39) missense probably damaging 1.00
R6072:Or4l1 UTSW 14 50,166,606 (GRCm39) missense probably damaging 1.00
R7816:Or4l1 UTSW 14 50,166,622 (GRCm39) missense probably damaging 1.00
R9359:Or4l1 UTSW 14 50,166,906 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGAACATCTGGGCCATGC -3'
(R):5'- CCTTATATGCTGGATGTGATATGATGC -3'

Sequencing Primer
(F):5'- GCAGCCCTGAAAAGAGATGCTC -3'
(R):5'- TTCAAGCTATGCTCTGATATGTTG -3'
Posted On 2022-05-16