Incidental Mutation 'R9403:Dpys'
ID 711364
Institutional Source Beutler Lab
Gene Symbol Dpys
Ensembl Gene ENSMUSG00000022304
Gene Name dihydropyrimidinase
Synonyms 1300004I01Rik, DHPase, 1200017I10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock # R9403 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 39768487-39857470 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 39828071 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Serine at position 285 (W285S)
Ref Sequence ENSEMBL: ENSMUSP00000022915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022915] [ENSMUST00000110306]
AlphaFold Q9EQF5
Predicted Effect probably damaging
Transcript: ENSMUST00000022915
AA Change: W285S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022915
Gene: ENSMUSG00000022304
AA Change: W285S

DomainStartEndE-ValueType
Pfam:Amidohydro_1 58 447 1.2e-39 PFAM
Pfam:Amidohydro_3 310 448 6.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110306
AA Change: W285S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105935
Gene: ENSMUSG00000022304
AA Change: W285S

DomainStartEndE-ValueType
Pfam:Amidohydro_5 25 98 8.3e-14 PFAM
Pfam:Amidohydro_4 53 404 4e-22 PFAM
Pfam:Amidohydro_1 58 407 1e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dihydropyrimidinase catalyzes the conversion of 5,6-dihydrouracil to 3-ureidopropionate in pyrimidine metabolism. Dihydropyrimidinase is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T G 6: 96,165,299 T255P probably benign Het
4930444G20Rik C T 10: 22,067,941 D47N possibly damaging Het
Angpt4 C T 2: 151,938,972 T380M probably damaging Het
Apoa5 G C 9: 46,270,646 R340P probably damaging Het
Cyp3a41a T A 5: 145,702,198 Y320F probably damaging Het
Dmtf1 A G 5: 9,121,927 L503S possibly damaging Het
Dock1 T C 7: 135,168,396 V1795A probably benign Het
Fam187b T C 7: 30,977,090 V8A Het
Fbn2 T C 18: 58,066,107 E1363G probably damaging Het
Glg1 C T 8: 111,187,793 R453Q probably benign Het
Gm5591 T A 7: 38,520,148 M434L probably benign Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Gpld1 G A 13: 24,979,729 V502I probably benign Het
Inhba A G 13: 16,017,381 H29R probably benign Het
Itga4 T A 2: 79,325,660 I990N possibly damaging Het
Kcnma1 T A 14: 23,543,077 I280L probably benign Het
Malrd1 T C 2: 15,614,177 V284A Het
Maml2 C T 9: 13,621,673 Q728* probably null Het
Mkln1 T C 6: 31,432,970 L181P probably damaging Het
Mms22l T C 4: 24,580,204 probably null Het
Muc16 A G 9: 18,537,764 probably null Het
Mylk C A 16: 34,875,642 S249* probably null Het
Naa35 G A 13: 59,601,003 A150T possibly damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nup205 G A 6: 35,199,974 R635H probably benign Het
Olfr263 T C 13: 21,133,695 F307L probably benign Het
Olfr723 T C 14: 49,929,449 T32A probably benign Het
Padi3 T C 4: 140,810,532 I26V probably benign Het
Polq T C 16: 37,061,853 S1460P probably benign Het
Ptgdr A G 14: 44,853,258 S348P Het
Qsox1 A G 1: 155,782,597 S409P probably damaging Het
Rergl T A 6: 139,494,854 Y99F possibly damaging Het
Rptn C A 3: 93,395,042 H22N probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 GGACCAGCTCAG GGACCAGCTCAGTCACGGTGACCAGCTCAG 7: 126,467,573 probably null Het
Sh2b1 ACCAGCTCAGCCACGGGG ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG 7: 126,467,575 probably benign Het
Slc2a3 A C 6: 122,736,610 I214M probably damaging Het
Slc5a7 A T 17: 54,276,641 N540K probably benign Het
Slco6c1 A T 1: 97,062,523 S664R possibly damaging Het
Tgm4 C A 9: 123,052,772 S344R probably damaging Het
Trim61 T A 8: 65,014,576 Q11L probably damaging Het
Trpm6 C A 19: 18,832,652 D1137E possibly damaging Het
Txndc2 G A 17: 65,637,997 T395I probably damaging Het
Txndc9 T C 1: 37,995,778 E15G probably benign Het
Vcpip1 A G 1: 9,745,824 I778T possibly damaging Het
Zfp383 T C 7: 29,915,259 F313S possibly damaging Het
Other mutations in Dpys
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Dpys APN 15 39846649 missense probably damaging 1.00
IGL01408:Dpys APN 15 39793306 missense possibly damaging 0.74
IGL02372:Dpys APN 15 39793271 missense probably benign 0.17
IGL02949:Dpys APN 15 39826883 missense probably damaging 0.97
IGL03357:Dpys APN 15 39824216 missense probably damaging 1.00
IGL02837:Dpys UTSW 15 39857305 missense probably damaging 1.00
PIT4468001:Dpys UTSW 15 39857205 missense probably damaging 0.96
R0315:Dpys UTSW 15 39857338 missense probably benign 0.01
R1252:Dpys UTSW 15 39824240 missense probably damaging 1.00
R2314:Dpys UTSW 15 39828090 missense possibly damaging 0.76
R2381:Dpys UTSW 15 39842054 missense probably damaging 1.00
R2961:Dpys UTSW 15 39784614 missense probably benign
R4653:Dpys UTSW 15 39793246 missense probably damaging 0.97
R4702:Dpys UTSW 15 39793402 missense possibly damaging 0.69
R4978:Dpys UTSW 15 39826936 missense possibly damaging 0.94
R5640:Dpys UTSW 15 39842066 missense probably damaging 1.00
R5714:Dpys UTSW 15 39857157 missense probably damaging 0.98
R5758:Dpys UTSW 15 39826999 missense possibly damaging 0.67
R6017:Dpys UTSW 15 39846718 missense probably null 0.04
R6482:Dpys UTSW 15 39841973 missense probably damaging 1.00
R6788:Dpys UTSW 15 39857163 missense probably damaging 1.00
R7090:Dpys UTSW 15 39826883 missense probably damaging 0.97
R7098:Dpys UTSW 15 39793331 missense probably damaging 1.00
R7869:Dpys UTSW 15 39793386 missense probably damaging 1.00
R8030:Dpys UTSW 15 39828090 missense possibly damaging 0.76
R8092:Dpys UTSW 15 39846614 missense probably benign 0.00
R8318:Dpys UTSW 15 39784665 missense probably benign
R8347:Dpys UTSW 15 39857313 missense probably benign 0.03
R8352:Dpys UTSW 15 39793324 missense possibly damaging 0.46
R8452:Dpys UTSW 15 39793324 missense possibly damaging 0.46
R8914:Dpys UTSW 15 39857223 missense probably benign
R9341:Dpys UTSW 15 39793352 missense possibly damaging 0.88
R9343:Dpys UTSW 15 39793352 missense possibly damaging 0.88
R9473:Dpys UTSW 15 39824187 missense possibly damaging 0.82
Z1177:Dpys UTSW 15 39842099 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CAGAAGGTCCTTGGATCTACAG -3'
(R):5'- TCTGGTTCACAAAAGTGAGGTG -3'

Sequencing Primer
(F):5'- GGTCCTTGGATCTACAGATTTAAGAC -3'
(R):5'- TTCACAAAAGTGAGGTGTGGGG -3'
Posted On 2022-05-16