Incidental Mutation 'R9404:Scn9a'
ID 711376
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Name sodium channel, voltage-gated, type IX, alpha
Synonyms PN1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9404 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 66480080-66634962 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 66526696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1087 (T1087I)
Ref Sequence ENSEMBL: ENSMUSP00000097642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
AlphaFold Q62205
Predicted Effect probably benign
Transcript: ENSMUST00000100063
AA Change: T1078I

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: T1078I

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100064
AA Change: T1087I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: T1087I

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112354
AA Change: T1076I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: T1076I

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164384
AA Change: T1087I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: T1087I

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169900
AA Change: T1076I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: T1076I

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 T C 4: 106,758,312 K314R possibly damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atad5 T C 11: 80,114,238 V1167A probably damaging Het
Bbs12 T C 3: 37,319,408 S2P probably damaging Het
Cdh11 A T 8: 102,679,622 L73Q probably damaging Het
Cdk15 A G 1: 59,289,755 E274G possibly damaging Het
Col27a1 T C 4: 63,275,941 V845A possibly damaging Het
Cyp3a11 T C 5: 145,862,448 T310A probably benign Het
Efcab5 G A 11: 77,132,108 T593I probably damaging Het
Ewsr1 A G 11: 5,072,940 M388T unknown Het
Fat2 A G 11: 55,253,522 probably null Het
Gm8225 T A 17: 26,543,060 I75N probably damaging Het
Gsap A G 5: 21,269,921 Y526C probably damaging Het
Hk1 T A 10: 62,296,080 I203F possibly damaging Het
Insl5 T C 4: 103,018,338 R72G probably benign Het
Iqcb1 T C 16: 36,851,270 V321A probably damaging Het
Iqcd A C 5: 120,600,536 T140P Het
Kcnt2 T A 1: 140,425,369 I272K probably damaging Het
Klhl25 A C 7: 75,865,405 I20L probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrba T C 3: 86,297,917 V356A probably damaging Het
Mast4 A G 13: 102,751,425 Y1159H probably damaging Het
Mavs T A 2: 131,241,898 L105Q probably damaging Het
Megf6 T A 4: 154,263,768 C902S Het
Mgea5 CTCGGGTC CTC 19: 45,754,657 probably null Het
Mmp17 A G 5: 129,605,677 D460G possibly damaging Het
Myh2 G T 11: 67,179,628 A466S probably damaging Het
Neb T C 2: 52,257,776 N2744D probably damaging Het
Olfr1197 T A 2: 88,729,207 M131L probably benign Het
Olfr169 C T 16: 19,565,981 V301M probably benign Het
Olfr213 T G 6: 116,540,747 I98S probably damaging Het
Olfr446 T C 6: 42,927,816 V195A probably benign Het
Olfr541 T A 7: 140,704,809 L186H probably damaging Het
Olfr972 A T 9: 39,873,412 I46F possibly damaging Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Pax5 G A 4: 44,645,565 P255S possibly damaging Het
Pcdhga2 A G 18: 37,670,014 T304A probably benign Het
Pcsk1 T G 13: 75,132,223 S722R probably benign Het
Pcsk9 C A 4: 106,454,526 R218L probably damaging Het
Pds5a T A 5: 65,618,964 I96F probably damaging Het
Pkdrej C A 15: 85,819,069 V889L probably benign Het
Plekhh2 A T 17: 84,571,040 probably null Het
Pnn A G 12: 59,071,972 E447G probably damaging Het
Ppp2r3a A G 9: 101,148,641 L289P probably damaging Het
Ppp6r2 A G 15: 89,268,550 H298R probably benign Het
Ptpn23 T C 9: 110,386,957 N1277S Het
Pus10 T A 11: 23,711,202 F263L possibly damaging Het
Rexo5 A G 7: 119,801,319 Y109C probably damaging Het
Rnf185 A T 11: 3,432,615 C23* probably null Het
Runx1 T C 16: 92,689,027 N140D probably benign Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 TC TCAGCCACGGGGACCAGCCC 7: 126,467,599 probably benign Het
Slc7a11 T C 3: 50,381,039 H350R possibly damaging Het
Spaca6 T C 17: 17,837,538 C155R probably damaging Het
Spire2 C T 8: 123,363,338 R580* probably null Het
Srgap3 A T 6: 112,729,655 M851K probably benign Het
Themis A G 10: 28,789,747 D602G probably benign Het
Tmem56 T C 3: 121,235,082 N52S probably benign Het
Trak2 T C 1: 58,921,137 T236A possibly damaging Het
Trrap T C 5: 144,815,415 C1709R possibly damaging Het
Ttn A T 2: 76,754,156 S22203T probably damaging Het
Ube3a A G 7: 59,287,015 T701A probably damaging Het
Ufl1 T C 4: 25,275,912 I164V probably benign Het
Vcpip1 T C 1: 9,747,631 T176A probably damaging Het
Virma T A 4: 11,513,626 D493E probably benign Het
Vmn2r77 T A 7: 86,802,039 W378R probably benign Het
Vps13b A T 15: 35,876,419 T2799S probably damaging Het
Vps8 T C 16: 21,608,177 S1337P probably benign Het
Zcchc6 A T 13: 59,799,887 N873K probably benign Het
Zfp235 A T 7: 24,140,437 I94F possibly damaging Het
Zfp3 A G 11: 70,772,540 K442E probably damaging Het
Zfp418 A T 7: 7,182,105 I356F possibly damaging Het
Zfp790 G A 7: 29,825,760 G68S probably benign Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66563601 missense probably damaging 1.00
IGL00570:Scn9a APN 2 66484142 missense probably damaging 1.00
IGL00809:Scn9a APN 2 66483935 missense probably damaging 1.00
IGL00977:Scn9a APN 2 66484301 missense probably damaging 0.99
IGL01120:Scn9a APN 2 66526972 missense probably benign 0.00
IGL01134:Scn9a APN 2 66504968 missense probably damaging 1.00
IGL01300:Scn9a APN 2 66488053 nonsense probably null
IGL01452:Scn9a APN 2 66527072 missense probably damaging 1.00
IGL01531:Scn9a APN 2 66537378 missense probably benign 0.11
IGL01572:Scn9a APN 2 66493886 missense probably benign 0.00
IGL01645:Scn9a APN 2 66487642 missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66484042 missense probably damaging 1.00
IGL01965:Scn9a APN 2 66484433 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66547135 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66494826 missense probably damaging 1.00
IGL02166:Scn9a APN 2 66493103 missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66484611 splice site probably benign
IGL02640:Scn9a APN 2 66536096 critical splice donor site probably null
IGL02685:Scn9a APN 2 66537293 missense probably damaging 1.00
IGL02798:Scn9a APN 2 66540559 missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66568029 missense probably damaging 1.00
IGL03008:Scn9a APN 2 66562511 missense probably damaging 1.00
IGL03270:Scn9a APN 2 66484014 missense probably damaging 1.00
IGL03408:Scn9a APN 2 66526747 missense probably benign 0.00
BB007:Scn9a UTSW 2 66504849 missense probably damaging 0.99
BB017:Scn9a UTSW 2 66504849 missense probably damaging 0.99
R0039:Scn9a UTSW 2 66562444 missense probably damaging 0.98
R0173:Scn9a UTSW 2 66533093 missense probably damaging 1.00
R0323:Scn9a UTSW 2 66568131 missense probably damaging 1.00
R0344:Scn9a UTSW 2 66505010 missense probably damaging 0.99
R0421:Scn9a UTSW 2 66543277 missense probably benign
R0465:Scn9a UTSW 2 66526996 missense probably damaging 1.00
R0514:Scn9a UTSW 2 66483678 missense probably damaging 1.00
R0599:Scn9a UTSW 2 66526799 missense probably damaging 0.96
R0627:Scn9a UTSW 2 66537377 missense probably benign 0.00
R0644:Scn9a UTSW 2 66533061 critical splice donor site probably null
R0653:Scn9a UTSW 2 66533377 missense probably damaging 1.00
R0685:Scn9a UTSW 2 66483499 missense probably benign 0.02
R0718:Scn9a UTSW 2 66547112 missense probably damaging 1.00
R0827:Scn9a UTSW 2 66536124 nonsense probably null
R0890:Scn9a UTSW 2 66483735 missense probably damaging 1.00
R1139:Scn9a UTSW 2 66504997 missense probably benign 0.02
R1385:Scn9a UTSW 2 66563542 missense probably damaging 1.00
R1398:Scn9a UTSW 2 66484586 missense probably benign 0.11
R1496:Scn9a UTSW 2 66526888 missense probably benign
R1511:Scn9a UTSW 2 66526813 missense probably benign 0.01
R1517:Scn9a UTSW 2 66505027 splice site probably benign
R1564:Scn9a UTSW 2 66484304 missense probably damaging 1.00
R1634:Scn9a UTSW 2 66488017 missense probably damaging 1.00
R1662:Scn9a UTSW 2 66483459 missense probably benign 0.00
R1695:Scn9a UTSW 2 66504876 nonsense probably null
R1709:Scn9a UTSW 2 66483506 missense probably damaging 1.00
R1741:Scn9a UTSW 2 66487594 missense probably damaging 0.99
R1755:Scn9a UTSW 2 66501716 missense probably benign 0.38
R1914:Scn9a UTSW 2 66566250 missense probably damaging 1.00
R1962:Scn9a UTSW 2 66484311 missense probably damaging 1.00
R1970:Scn9a UTSW 2 66515380 missense probably damaging 0.97
R2017:Scn9a UTSW 2 66515321 missense probably damaging 0.99
R2092:Scn9a UTSW 2 66533376 missense probably damaging 0.99
R2105:Scn9a UTSW 2 66568183 missense probably benign 0.25
R2114:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2115:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2128:Scn9a UTSW 2 66526654 missense probably damaging 1.00
R2157:Scn9a UTSW 2 66536325 missense probably damaging 1.00
R2162:Scn9a UTSW 2 66534229 missense probably damaging 0.98
R2350:Scn9a UTSW 2 66504968 missense probably damaging 1.00
R3694:Scn9a UTSW 2 66562405 missense probably benign
R3771:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3772:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3773:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3922:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66565054 intron probably benign
R4385:Scn9a UTSW 2 66484556 missense probably damaging 1.00
R4415:Scn9a UTSW 2 66526693 missense probably damaging 1.00
R4570:Scn9a UTSW 2 66483558 missense possibly damaging 0.85
R4682:Scn9a UTSW 2 66547018 missense probably benign
R4783:Scn9a UTSW 2 66540623 missense probably benign 0.01
R4822:Scn9a UTSW 2 66483749 missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66551713 missense probably benign
R4908:Scn9a UTSW 2 66526743 missense probably benign 0.03
R4983:Scn9a UTSW 2 66566270 missense probably benign 0.02
R5047:Scn9a UTSW 2 66562480 missense probably damaging 1.00
R5100:Scn9a UTSW 2 66534119 missense probably damaging 1.00
R5140:Scn9a UTSW 2 66565167 missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66488043 missense probably damaging 1.00
R5557:Scn9a UTSW 2 66547103 missense probably damaging 0.99
R5582:Scn9a UTSW 2 66565029 intron probably benign
R6108:Scn9a UTSW 2 66484049 missense probably damaging 1.00
R6115:Scn9a UTSW 2 66563629 missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66487524 missense probably benign 0.00
R6261:Scn9a UTSW 2 66483896 missense probably damaging 1.00
R6335:Scn9a UTSW 2 66568264 start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66526963 missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66483502 missense probably benign 0.23
R6681:Scn9a UTSW 2 66563342 missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66568029 missense probably damaging 1.00
R7102:Scn9a UTSW 2 66549015 missense probably damaging 1.00
R7186:Scn9a UTSW 2 66534223 missense probably damaging 1.00
R7243:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R7311:Scn9a UTSW 2 66484404 missense possibly damaging 0.54
R7328:Scn9a UTSW 2 66484587 missense probably benign
R7386:Scn9a UTSW 2 66540550 missense probably damaging 1.00
R7438:Scn9a UTSW 2 66547187 missense possibly damaging 0.81
R7483:Scn9a UTSW 2 66533348 missense probably damaging 0.99
R7485:Scn9a UTSW 2 66534217 missense probably damaging 1.00
R7526:Scn9a UTSW 2 66483646 missense probably benign
R7617:Scn9a UTSW 2 66540549 missense possibly damaging 0.55
R7642:Scn9a UTSW 2 66536236 missense probably benign 0.02
R7653:Scn9a UTSW 2 66527080 missense probably damaging 1.00
R7747:Scn9a UTSW 2 66484298 missense probably damaging 1.00
R7823:Scn9a UTSW 2 66483791 missense probably damaging 1.00
R7864:Scn9a UTSW 2 66484560 missense possibly damaging 0.73
R7890:Scn9a UTSW 2 66543112 missense probably benign 0.00
R7930:Scn9a UTSW 2 66504849 missense probably damaging 0.99
R7975:Scn9a UTSW 2 66484253 missense probably damaging 1.00
R8057:Scn9a UTSW 2 66515430 missense probably benign 0.06
R8145:Scn9a UTSW 2 66487410 missense probably damaging 1.00
R8163:Scn9a UTSW 2 66484401 missense probably damaging 1.00
R8165:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R8342:Scn9a UTSW 2 66536282 missense probably benign
R8345:Scn9a UTSW 2 66494622 missense probably damaging 0.96
R8464:Scn9a UTSW 2 66566281 missense probably damaging 0.99
R8467:Scn9a UTSW 2 66501671 missense probably damaging 1.00
R8698:Scn9a UTSW 2 66536284 missense probably benign 0.00
R8810:Scn9a UTSW 2 66501666 missense probably damaging 1.00
R8822:Scn9a UTSW 2 66540635 missense probably damaging 0.99
R8829:Scn9a UTSW 2 66483617 missense probably benign
R9009:Scn9a UTSW 2 66508583 missense probably damaging 1.00
R9038:Scn9a UTSW 2 66494803 missense probably damaging 1.00
R9126:Scn9a UTSW 2 66484400 missense probably damaging 1.00
R9205:Scn9a UTSW 2 66533313 missense probably damaging 1.00
R9300:Scn9a UTSW 2 66504892 missense probably benign 0.39
R9373:Scn9a UTSW 2 66483917 missense probably benign 0.00
R9443:Scn9a UTSW 2 66565209 missense probably damaging 1.00
X0003:Scn9a UTSW 2 66508647 missense probably benign 0.02
X0062:Scn9a UTSW 2 66568077 missense probably damaging 1.00
Z1176:Scn9a UTSW 2 66540592 missense probably benign 0.00
Z1177:Scn9a UTSW 2 66494685 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GCATGGGCAACATTAGACCTG -3'
(R):5'- AACAGACCCTGCGTGAATTC -3'

Sequencing Primer
(F):5'- TGGGCAACATTAGACCTGAGATATC -3'
(R):5'- GACCCTGCGTGAATTCATTCTAAAG -3'
Posted On 2022-05-16