Incidental Mutation 'R9404:Slc7a11'
ID 711381
Institutional Source Beutler Lab
Gene Symbol Slc7a11
Ensembl Gene ENSMUSG00000027737
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonyms sut, System x, x, xCT, 9930009M05Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9404 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 50319385-50403947 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 50335488 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 350 (H350R)
Ref Sequence ENSEMBL: ENSMUSP00000029297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029297] [ENSMUST00000194462]
AlphaFold Q9WTR6
Predicted Effect possibly damaging
Transcript: ENSMUST00000029297
AA Change: H350R

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029297
Gene: ENSMUSG00000027737
AA Change: H350R

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 3.3e-61 PFAM
Pfam:AA_permease 49 478 1.1e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000194462
AA Change: H350R

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141988
Gene: ENSMUSG00000027737
AA Change: H350R

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 1.1e-60 PFAM
Pfam:AA_permease 49 479 2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice show a reduction in yellow pigment resulting in dilution of agouti; only pinna hairs are affected in nonagouti mice. Mice homozygous for an ENU-induced allele exhibit decreased survival of LPS-induced macrophages and increased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 T C 4: 106,615,509 (GRCm39) K314R possibly damaging Het
Armt1 AC A 10: 4,400,848 (GRCm39) probably null Het
Atad5 T C 11: 80,005,064 (GRCm39) V1167A probably damaging Het
Bbs12 T C 3: 37,373,557 (GRCm39) S2P probably damaging Het
Cdh11 A T 8: 103,406,254 (GRCm39) L73Q probably damaging Het
Cdk15 A G 1: 59,328,914 (GRCm39) E274G possibly damaging Het
Col27a1 T C 4: 63,194,178 (GRCm39) V845A possibly damaging Het
Cyp3a11 T C 5: 145,799,258 (GRCm39) T310A probably benign Het
Efcab5 G A 11: 77,022,934 (GRCm39) T593I probably damaging Het
Ewsr1 A G 11: 5,022,940 (GRCm39) M388T unknown Het
Fat2 A G 11: 55,144,348 (GRCm39) probably null Het
Gm8225 T A 17: 26,762,034 (GRCm39) I75N probably damaging Het
Gsap A G 5: 21,474,919 (GRCm39) Y526C probably damaging Het
Hk1 T A 10: 62,131,859 (GRCm39) I203F possibly damaging Het
Insl5 T C 4: 102,875,535 (GRCm39) R72G probably benign Het
Iqcb1 T C 16: 36,671,632 (GRCm39) V321A probably damaging Het
Iqcd A C 5: 120,738,601 (GRCm39) T140P Het
Kcnt2 T A 1: 140,353,107 (GRCm39) I272K probably damaging Het
Klhl25 A C 7: 75,515,153 (GRCm39) I20L probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lrba T C 3: 86,205,224 (GRCm39) V356A probably damaging Het
Mast4 A G 13: 102,887,933 (GRCm39) Y1159H probably damaging Het
Mavs T A 2: 131,083,818 (GRCm39) L105Q probably damaging Het
Megf6 T A 4: 154,348,225 (GRCm39) C902S Het
Mmp17 A G 5: 129,682,741 (GRCm39) D460G possibly damaging Het
Myh2 G T 11: 67,070,454 (GRCm39) A466S probably damaging Het
Neb T C 2: 52,147,788 (GRCm39) N2744D probably damaging Het
Oga CTCGGGTC CTC 19: 45,743,096 (GRCm39) probably null Het
Or13a26 T A 7: 140,284,722 (GRCm39) L186H probably damaging Het
Or2a12 T C 6: 42,904,750 (GRCm39) V195A probably benign Het
Or2aj4 C T 16: 19,384,731 (GRCm39) V301M probably benign Het
Or4a27 T A 2: 88,559,551 (GRCm39) M131L probably benign Het
Or6d13 T G 6: 116,517,708 (GRCm39) I98S probably damaging Het
Or8g55 A T 9: 39,784,708 (GRCm39) I46F possibly damaging Het
Parpbp A G 10: 87,950,411 (GRCm39) V323A possibly damaging Het
Pax5 G A 4: 44,645,565 (GRCm39) P255S possibly damaging Het
Pcdhga2 A G 18: 37,803,067 (GRCm39) T304A probably benign Het
Pcsk1 T G 13: 75,280,342 (GRCm39) S722R probably benign Het
Pcsk9 C A 4: 106,311,723 (GRCm39) R218L probably damaging Het
Pds5a T A 5: 65,776,307 (GRCm39) I96F probably damaging Het
Pkdrej C A 15: 85,703,270 (GRCm39) V889L probably benign Het
Plekhh2 A T 17: 84,878,468 (GRCm39) probably null Het
Pnn A G 12: 59,118,758 (GRCm39) E447G probably damaging Het
Ppp2r3d A G 9: 101,025,840 (GRCm39) L289P probably damaging Het
Ppp6r2 A G 15: 89,152,753 (GRCm39) H298R probably benign Het
Ptpn23 T C 9: 110,216,025 (GRCm39) N1277S Het
Pus10 T A 11: 23,661,202 (GRCm39) F263L possibly damaging Het
Rexo5 A G 7: 119,400,542 (GRCm39) Y109C probably damaging Het
Rnf185 A T 11: 3,382,615 (GRCm39) C23* probably null Het
Runx1 T C 16: 92,485,915 (GRCm39) N140D probably benign Het
Sbf2 T C 7: 110,040,702 (GRCm39) Q375R possibly damaging Het
Scn9a G A 2: 66,357,040 (GRCm39) T1087I probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Sh2b1 TC TCAGCCACGGGGACCAGCCC 7: 126,066,771 (GRCm39) probably benign Het
Spaca6 T C 17: 18,057,800 (GRCm39) C155R probably damaging Het
Spire2 C T 8: 124,090,077 (GRCm39) R580* probably null Het
Srgap3 A T 6: 112,706,616 (GRCm39) M851K probably benign Het
Themis A G 10: 28,665,743 (GRCm39) D602G probably benign Het
Tlcd4 T C 3: 121,028,731 (GRCm39) N52S probably benign Het
Trak2 T C 1: 58,960,296 (GRCm39) T236A possibly damaging Het
Trrap T C 5: 144,752,225 (GRCm39) C1709R possibly damaging Het
Ttn A T 2: 76,584,500 (GRCm39) S22203T probably damaging Het
Tut7 A T 13: 59,947,701 (GRCm39) N873K probably benign Het
Ube3a A G 7: 58,936,763 (GRCm39) T701A probably damaging Het
Ufl1 T C 4: 25,275,912 (GRCm39) I164V probably benign Het
Vcpip1 T C 1: 9,817,856 (GRCm39) T176A probably damaging Het
Virma T A 4: 11,513,626 (GRCm39) D493E probably benign Het
Vmn2r77 T A 7: 86,451,247 (GRCm39) W378R probably benign Het
Vps13b A T 15: 35,876,565 (GRCm39) T2799S probably damaging Het
Vps8 T C 16: 21,426,927 (GRCm39) S1337P probably benign Het
Zfp235 A T 7: 23,839,862 (GRCm39) I94F possibly damaging Het
Zfp3 A G 11: 70,663,366 (GRCm39) K442E probably damaging Het
Zfp418 A T 7: 7,185,104 (GRCm39) I356F possibly damaging Het
Zfp790 G A 7: 29,525,185 (GRCm39) G68S probably benign Het
Other mutations in Slc7a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Slc7a11 APN 3 50,382,136 (GRCm39) missense probably benign 0.06
IGL00990:Slc7a11 APN 3 50,333,518 (GRCm39) missense probably damaging 1.00
IGL01755:Slc7a11 APN 3 50,378,516 (GRCm39) missense probably benign 0.39
IGL03105:Slc7a11 APN 3 50,326,788 (GRCm39) missense possibly damaging 0.67
IGL03141:Slc7a11 APN 3 50,336,334 (GRCm39) missense possibly damaging 0.66
R0468:Slc7a11 UTSW 3 50,338,500 (GRCm39) missense probably damaging 1.00
R0735:Slc7a11 UTSW 3 50,378,545 (GRCm39) missense probably benign 0.00
R1363:Slc7a11 UTSW 3 50,378,500 (GRCm39) missense probably damaging 1.00
R1466:Slc7a11 UTSW 3 50,335,522 (GRCm39) splice site probably null
R1466:Slc7a11 UTSW 3 50,335,522 (GRCm39) splice site probably null
R1554:Slc7a11 UTSW 3 50,336,345 (GRCm39) missense probably damaging 1.00
R1734:Slc7a11 UTSW 3 50,326,795 (GRCm39) nonsense probably null
R2128:Slc7a11 UTSW 3 50,338,558 (GRCm39) missense probably damaging 0.97
R2504:Slc7a11 UTSW 3 50,332,195 (GRCm39) splice site probably null
R3116:Slc7a11 UTSW 3 50,338,588 (GRCm39) missense probably benign 0.13
R3981:Slc7a11 UTSW 3 50,382,223 (GRCm39) missense probably benign
R4479:Slc7a11 UTSW 3 50,372,412 (GRCm39) intron probably benign
R5117:Slc7a11 UTSW 3 50,333,599 (GRCm39) missense probably damaging 0.99
R5586:Slc7a11 UTSW 3 50,397,532 (GRCm39) missense possibly damaging 0.95
R5621:Slc7a11 UTSW 3 50,393,324 (GRCm39) missense probably damaging 1.00
R5689:Slc7a11 UTSW 3 50,326,780 (GRCm39) missense probably benign 0.01
R5692:Slc7a11 UTSW 3 50,326,780 (GRCm39) missense probably benign 0.01
R5965:Slc7a11 UTSW 3 50,333,593 (GRCm39) missense probably benign 0.00
R6338:Slc7a11 UTSW 3 50,338,492 (GRCm39) critical splice donor site probably null
R7177:Slc7a11 UTSW 3 50,397,680 (GRCm39) missense probably benign 0.00
R7337:Slc7a11 UTSW 3 50,397,448 (GRCm39) missense possibly damaging 0.50
R7634:Slc7a11 UTSW 3 50,378,486 (GRCm39) splice site probably null
R7756:Slc7a11 UTSW 3 50,326,809 (GRCm39) missense probably benign
R7758:Slc7a11 UTSW 3 50,326,809 (GRCm39) missense probably benign
R7821:Slc7a11 UTSW 3 50,335,476 (GRCm39) missense probably damaging 1.00
R8112:Slc7a11 UTSW 3 50,372,440 (GRCm39) missense possibly damaging 0.92
R8218:Slc7a11 UTSW 3 50,378,501 (GRCm39) missense probably damaging 1.00
R8255:Slc7a11 UTSW 3 50,382,177 (GRCm39) missense probably damaging 0.98
R8318:Slc7a11 UTSW 3 50,372,435 (GRCm39) critical splice donor site probably null
R8396:Slc7a11 UTSW 3 50,338,578 (GRCm39) missense possibly damaging 0.78
R8857:Slc7a11 UTSW 3 50,393,305 (GRCm39) missense probably damaging 1.00
R8967:Slc7a11 UTSW 3 50,338,564 (GRCm39) missense probably benign 0.00
R9044:Slc7a11 UTSW 3 50,333,632 (GRCm39) missense probably benign 0.20
R9104:Slc7a11 UTSW 3 50,332,082 (GRCm39) missense probably benign 0.01
R9500:Slc7a11 UTSW 3 50,382,201 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCATTGCAACATCTCTGG -3'
(R):5'- ATGATGAAATCTGCCCTTTGTTTCC -3'

Sequencing Primer
(F):5'- TGGCCTCCCAGAAAATGATACATGG -3'
(R):5'- TGTTTCCAAAGCACAACTCAAATG -3'
Posted On 2022-05-16