Incidental Mutation 'R9404:Trrap'
ID 711396
Institutional Source Beutler Lab
Gene Symbol Trrap
Ensembl Gene ENSMUSG00000045482
Gene Name transformation/transcription domain-associated protein
Synonyms transactivation/transformation-domain associated protein
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9404 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 144704547-144796588 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144752225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 1709 (C1709R)
Ref Sequence ENSEMBL: ENSMUSP00000098035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000038980
AA Change: C1709R

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: C1709R

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3363 3376 N/A INTRINSIC
low complexity region 3407 3418 N/A INTRINSIC
PI3Kc 3509 3798 5.11e-8 SMART
FATC 3797 3829 1.89e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094120
AA Change: C1727R

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: C1727R

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1682 2e-6 SMART
low complexity region 1850 1861 N/A INTRINSIC
low complexity region 1884 1899 N/A INTRINSIC
low complexity region 2307 2321 N/A INTRINSIC
Pfam:FAT 2848 3203 1.1e-68 PFAM
low complexity region 3392 3405 N/A INTRINSIC
low complexity region 3436 3447 N/A INTRINSIC
PI3Kc 3538 3827 5.11e-8 SMART
FATC 3826 3858 1.89e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100467
AA Change: C1709R

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: C1709R

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3381 3394 N/A INTRINSIC
low complexity region 3425 3436 N/A INTRINSIC
PI3Kc 3527 3816 5.11e-8 SMART
FATC 3815 3847 1.89e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: C1448R

DomainStartEndE-ValueType
low complexity region 197 242 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
SCOP:d1gw5a_ 474 1003 9e-7 SMART
Blast:PI3Kc 480 579 1e-13 BLAST
low complexity region 1083 1092 N/A INTRINSIC
low complexity region 1572 1583 N/A INTRINSIC
low complexity region 1606 1621 N/A INTRINSIC
low complexity region 2029 2043 N/A INTRINSIC
Pfam:FAT 2570 2914 1.5e-69 PFAM
low complexity region 3121 3134 N/A INTRINSIC
low complexity region 3165 3176 N/A INTRINSIC
PI3Kc 3267 3556 5.11e-8 SMART
FATC 3555 3587 1.89e-3 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 T C 4: 106,615,509 (GRCm39) K314R possibly damaging Het
Armt1 AC A 10: 4,400,848 (GRCm39) probably null Het
Atad5 T C 11: 80,005,064 (GRCm39) V1167A probably damaging Het
Bbs12 T C 3: 37,373,557 (GRCm39) S2P probably damaging Het
Cdh11 A T 8: 103,406,254 (GRCm39) L73Q probably damaging Het
Cdk15 A G 1: 59,328,914 (GRCm39) E274G possibly damaging Het
Col27a1 T C 4: 63,194,178 (GRCm39) V845A possibly damaging Het
Cyp3a11 T C 5: 145,799,258 (GRCm39) T310A probably benign Het
Efcab5 G A 11: 77,022,934 (GRCm39) T593I probably damaging Het
Ewsr1 A G 11: 5,022,940 (GRCm39) M388T unknown Het
Fat2 A G 11: 55,144,348 (GRCm39) probably null Het
Gm8225 T A 17: 26,762,034 (GRCm39) I75N probably damaging Het
Gsap A G 5: 21,474,919 (GRCm39) Y526C probably damaging Het
Hk1 T A 10: 62,131,859 (GRCm39) I203F possibly damaging Het
Insl5 T C 4: 102,875,535 (GRCm39) R72G probably benign Het
Iqcb1 T C 16: 36,671,632 (GRCm39) V321A probably damaging Het
Iqcd A C 5: 120,738,601 (GRCm39) T140P Het
Kcnt2 T A 1: 140,353,107 (GRCm39) I272K probably damaging Het
Klhl25 A C 7: 75,515,153 (GRCm39) I20L probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lrba T C 3: 86,205,224 (GRCm39) V356A probably damaging Het
Mast4 A G 13: 102,887,933 (GRCm39) Y1159H probably damaging Het
Mavs T A 2: 131,083,818 (GRCm39) L105Q probably damaging Het
Megf6 T A 4: 154,348,225 (GRCm39) C902S Het
Mmp17 A G 5: 129,682,741 (GRCm39) D460G possibly damaging Het
Myh2 G T 11: 67,070,454 (GRCm39) A466S probably damaging Het
Neb T C 2: 52,147,788 (GRCm39) N2744D probably damaging Het
Oga CTCGGGTC CTC 19: 45,743,096 (GRCm39) probably null Het
Or13a26 T A 7: 140,284,722 (GRCm39) L186H probably damaging Het
Or2a12 T C 6: 42,904,750 (GRCm39) V195A probably benign Het
Or2aj4 C T 16: 19,384,731 (GRCm39) V301M probably benign Het
Or4a27 T A 2: 88,559,551 (GRCm39) M131L probably benign Het
Or6d13 T G 6: 116,517,708 (GRCm39) I98S probably damaging Het
Or8g55 A T 9: 39,784,708 (GRCm39) I46F possibly damaging Het
Parpbp A G 10: 87,950,411 (GRCm39) V323A possibly damaging Het
Pax5 G A 4: 44,645,565 (GRCm39) P255S possibly damaging Het
Pcdhga2 A G 18: 37,803,067 (GRCm39) T304A probably benign Het
Pcsk1 T G 13: 75,280,342 (GRCm39) S722R probably benign Het
Pcsk9 C A 4: 106,311,723 (GRCm39) R218L probably damaging Het
Pds5a T A 5: 65,776,307 (GRCm39) I96F probably damaging Het
Pkdrej C A 15: 85,703,270 (GRCm39) V889L probably benign Het
Plekhh2 A T 17: 84,878,468 (GRCm39) probably null Het
Pnn A G 12: 59,118,758 (GRCm39) E447G probably damaging Het
Ppp2r3d A G 9: 101,025,840 (GRCm39) L289P probably damaging Het
Ppp6r2 A G 15: 89,152,753 (GRCm39) H298R probably benign Het
Ptpn23 T C 9: 110,216,025 (GRCm39) N1277S Het
Pus10 T A 11: 23,661,202 (GRCm39) F263L possibly damaging Het
Rexo5 A G 7: 119,400,542 (GRCm39) Y109C probably damaging Het
Rnf185 A T 11: 3,382,615 (GRCm39) C23* probably null Het
Runx1 T C 16: 92,485,915 (GRCm39) N140D probably benign Het
Sbf2 T C 7: 110,040,702 (GRCm39) Q375R possibly damaging Het
Scn9a G A 2: 66,357,040 (GRCm39) T1087I probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Sh2b1 TC TCAGCCACGGGGACCAGCCC 7: 126,066,771 (GRCm39) probably benign Het
Slc7a11 T C 3: 50,335,488 (GRCm39) H350R possibly damaging Het
Spaca6 T C 17: 18,057,800 (GRCm39) C155R probably damaging Het
Spire2 C T 8: 124,090,077 (GRCm39) R580* probably null Het
Srgap3 A T 6: 112,706,616 (GRCm39) M851K probably benign Het
Themis A G 10: 28,665,743 (GRCm39) D602G probably benign Het
Tlcd4 T C 3: 121,028,731 (GRCm39) N52S probably benign Het
Trak2 T C 1: 58,960,296 (GRCm39) T236A possibly damaging Het
Ttn A T 2: 76,584,500 (GRCm39) S22203T probably damaging Het
Tut7 A T 13: 59,947,701 (GRCm39) N873K probably benign Het
Ube3a A G 7: 58,936,763 (GRCm39) T701A probably damaging Het
Ufl1 T C 4: 25,275,912 (GRCm39) I164V probably benign Het
Vcpip1 T C 1: 9,817,856 (GRCm39) T176A probably damaging Het
Virma T A 4: 11,513,626 (GRCm39) D493E probably benign Het
Vmn2r77 T A 7: 86,451,247 (GRCm39) W378R probably benign Het
Vps13b A T 15: 35,876,565 (GRCm39) T2799S probably damaging Het
Vps8 T C 16: 21,426,927 (GRCm39) S1337P probably benign Het
Zfp235 A T 7: 23,839,862 (GRCm39) I94F possibly damaging Het
Zfp3 A G 11: 70,663,366 (GRCm39) K442E probably damaging Het
Zfp418 A T 7: 7,185,104 (GRCm39) I356F possibly damaging Het
Zfp790 G A 7: 29,525,185 (GRCm39) G68S probably benign Het
Other mutations in Trrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Trrap APN 5 144,716,784 (GRCm39) splice site probably benign
IGL00470:Trrap APN 5 144,754,848 (GRCm39) missense probably damaging 1.00
IGL00490:Trrap APN 5 144,762,035 (GRCm39) missense probably benign 0.40
IGL01072:Trrap APN 5 144,721,065 (GRCm39) splice site probably benign
IGL01087:Trrap APN 5 144,783,349 (GRCm39) missense probably damaging 0.99
IGL01300:Trrap APN 5 144,741,628 (GRCm39) missense probably damaging 1.00
IGL01350:Trrap APN 5 144,767,779 (GRCm39) missense possibly damaging 0.92
IGL01410:Trrap APN 5 144,767,831 (GRCm39) missense probably benign 0.00
IGL01571:Trrap APN 5 144,770,097 (GRCm39) splice site probably benign
IGL01748:Trrap APN 5 144,770,150 (GRCm39) missense probably damaging 1.00
IGL01839:Trrap APN 5 144,758,685 (GRCm39) missense probably damaging 1.00
IGL01976:Trrap APN 5 144,793,799 (GRCm39) missense probably benign 0.00
IGL02075:Trrap APN 5 144,765,304 (GRCm39) missense probably benign 0.00
IGL02127:Trrap APN 5 144,753,243 (GRCm39) missense probably benign 0.22
IGL02131:Trrap APN 5 144,777,246 (GRCm39) missense probably damaging 1.00
IGL02287:Trrap APN 5 144,769,348 (GRCm39) missense probably damaging 1.00
IGL02301:Trrap APN 5 144,714,727 (GRCm39) missense probably benign 0.05
IGL02336:Trrap APN 5 144,735,200 (GRCm39) missense probably benign 0.39
IGL02526:Trrap APN 5 144,761,360 (GRCm39) missense probably benign 0.00
IGL02873:Trrap APN 5 144,777,889 (GRCm39) splice site probably benign
IGL02953:Trrap APN 5 144,752,774 (GRCm39) missense probably damaging 0.99
IGL03404:Trrap APN 5 144,769,996 (GRCm39) missense probably benign 0.00
Buffer UTSW 5 144,771,014 (GRCm39) missense probably benign 0.06
Card-tower UTSW 5 144,741,576 (GRCm39) missense probably damaging 1.00
Cookie UTSW 5 144,730,859 (GRCm39) missense probably damaging 1.00
Glass_house UTSW 5 144,782,287 (GRCm39) missense possibly damaging 0.67
Immovable UTSW 5 144,727,665 (GRCm39) missense possibly damaging 0.66
R5049_trrap_520 UTSW 5 144,763,527 (GRCm39) missense probably damaging 1.00
R7167_Trrap_977 UTSW 5 144,776,424 (GRCm39) missense probably benign 0.39
vitreous UTSW 5 144,742,537 (GRCm39) missense probably damaging 1.00
PIT4243001:Trrap UTSW 5 144,733,781 (GRCm39) missense probably benign 0.00
PIT4466001:Trrap UTSW 5 144,765,410 (GRCm39) missense probably benign 0.02
R0062:Trrap UTSW 5 144,719,003 (GRCm39) splice site probably benign
R0062:Trrap UTSW 5 144,719,003 (GRCm39) splice site probably benign
R0112:Trrap UTSW 5 144,759,571 (GRCm39) nonsense probably null
R0126:Trrap UTSW 5 144,742,560 (GRCm39) nonsense probably null
R0257:Trrap UTSW 5 144,741,045 (GRCm39) missense probably benign 0.31
R0325:Trrap UTSW 5 144,753,205 (GRCm39) missense probably benign 0.05
R0376:Trrap UTSW 5 144,753,149 (GRCm39) missense probably benign 0.03
R0396:Trrap UTSW 5 144,751,366 (GRCm39) missense probably damaging 0.99
R0448:Trrap UTSW 5 144,776,377 (GRCm39) missense possibly damaging 0.66
R0454:Trrap UTSW 5 144,783,287 (GRCm39) missense probably damaging 1.00
R0711:Trrap UTSW 5 144,790,309 (GRCm39) missense probably damaging 1.00
R0827:Trrap UTSW 5 144,751,640 (GRCm39) missense probably benign 0.00
R1005:Trrap UTSW 5 144,742,537 (GRCm39) missense probably damaging 1.00
R1147:Trrap UTSW 5 144,741,576 (GRCm39) missense probably damaging 1.00
R1147:Trrap UTSW 5 144,741,576 (GRCm39) missense probably damaging 1.00
R1179:Trrap UTSW 5 144,714,749 (GRCm39) missense possibly damaging 0.94
R1218:Trrap UTSW 5 144,753,219 (GRCm39) missense probably damaging 1.00
R1264:Trrap UTSW 5 144,726,409 (GRCm39) splice site probably benign
R1374:Trrap UTSW 5 144,783,428 (GRCm39) missense probably damaging 1.00
R1401:Trrap UTSW 5 144,794,232 (GRCm39) missense possibly damaging 0.93
R1480:Trrap UTSW 5 144,755,123 (GRCm39) missense probably benign
R1538:Trrap UTSW 5 144,774,012 (GRCm39) missense possibly damaging 0.65
R1751:Trrap UTSW 5 144,751,385 (GRCm39) critical splice donor site probably null
R1779:Trrap UTSW 5 144,765,400 (GRCm39) missense probably benign 0.01
R1782:Trrap UTSW 5 144,759,513 (GRCm39) missense possibly damaging 0.93
R1792:Trrap UTSW 5 144,790,396 (GRCm39) missense possibly damaging 0.87
R1859:Trrap UTSW 5 144,767,761 (GRCm39) missense probably benign 0.04
R1861:Trrap UTSW 5 144,752,727 (GRCm39) splice site probably null
R1902:Trrap UTSW 5 144,752,863 (GRCm39) missense probably damaging 1.00
R1903:Trrap UTSW 5 144,752,863 (GRCm39) missense probably damaging 1.00
R2021:Trrap UTSW 5 144,790,298 (GRCm39) missense possibly damaging 0.94
R2026:Trrap UTSW 5 144,739,854 (GRCm39) missense possibly damaging 0.86
R2036:Trrap UTSW 5 144,765,372 (GRCm39) missense probably benign 0.08
R2099:Trrap UTSW 5 144,719,049 (GRCm39) missense possibly damaging 0.46
R2108:Trrap UTSW 5 144,762,684 (GRCm39) missense probably benign 0.01
R2113:Trrap UTSW 5 144,781,021 (GRCm39) missense probably damaging 1.00
R2174:Trrap UTSW 5 144,758,665 (GRCm39) missense probably benign 0.40
R2442:Trrap UTSW 5 144,754,776 (GRCm39) missense probably damaging 1.00
R2568:Trrap UTSW 5 144,780,179 (GRCm39) critical splice donor site probably null
R3442:Trrap UTSW 5 144,729,062 (GRCm39) missense probably benign 0.03
R3853:Trrap UTSW 5 144,728,975 (GRCm39) missense probably damaging 1.00
R4401:Trrap UTSW 5 144,780,128 (GRCm39) missense possibly damaging 0.60
R4493:Trrap UTSW 5 144,767,858 (GRCm39) missense probably benign 0.21
R4524:Trrap UTSW 5 144,762,131 (GRCm39) missense probably benign 0.38
R4569:Trrap UTSW 5 144,728,928 (GRCm39) missense probably benign 0.13
R4672:Trrap UTSW 5 144,722,290 (GRCm39) missense probably damaging 0.97
R4732:Trrap UTSW 5 144,753,380 (GRCm39) missense probably damaging 1.00
R4733:Trrap UTSW 5 144,753,380 (GRCm39) missense probably damaging 1.00
R4791:Trrap UTSW 5 144,740,087 (GRCm39) missense probably damaging 1.00
R4795:Trrap UTSW 5 144,769,298 (GRCm39) missense probably benign 0.06
R4827:Trrap UTSW 5 144,737,758 (GRCm39) missense probably benign 0.02
R4839:Trrap UTSW 5 144,782,402 (GRCm39) missense probably damaging 1.00
R4915:Trrap UTSW 5 144,742,545 (GRCm39) missense probably damaging 0.99
R4951:Trrap UTSW 5 144,742,530 (GRCm39) missense possibly damaging 0.65
R4959:Trrap UTSW 5 144,793,770 (GRCm39) missense probably damaging 1.00
R5049:Trrap UTSW 5 144,763,527 (GRCm39) missense probably damaging 1.00
R5074:Trrap UTSW 5 144,787,989 (GRCm39) missense probably damaging 1.00
R5236:Trrap UTSW 5 144,754,596 (GRCm39) missense probably benign 0.07
R5281:Trrap UTSW 5 144,750,313 (GRCm39) missense probably benign 0.13
R5322:Trrap UTSW 5 144,781,034 (GRCm39) missense probably damaging 1.00
R5457:Trrap UTSW 5 144,786,787 (GRCm39) missense probably damaging 1.00
R5590:Trrap UTSW 5 144,719,075 (GRCm39) missense probably benign 0.05
R5799:Trrap UTSW 5 144,767,755 (GRCm39) missense probably benign
R5885:Trrap UTSW 5 144,731,603 (GRCm39) missense probably damaging 1.00
R5905:Trrap UTSW 5 144,786,730 (GRCm39) missense possibly damaging 0.95
R5908:Trrap UTSW 5 144,723,518 (GRCm39) missense probably damaging 0.96
R5956:Trrap UTSW 5 144,744,201 (GRCm39) splice site silent
R5992:Trrap UTSW 5 144,746,994 (GRCm39) missense probably benign 0.00
R6017:Trrap UTSW 5 144,781,051 (GRCm39) missense probably damaging 1.00
R6029:Trrap UTSW 5 144,762,724 (GRCm39) missense possibly damaging 0.75
R6029:Trrap UTSW 5 144,754,489 (GRCm39) missense possibly damaging 0.94
R6117:Trrap UTSW 5 144,739,771 (GRCm39) missense possibly damaging 0.78
R6166:Trrap UTSW 5 144,718,791 (GRCm39) missense possibly damaging 0.66
R6234:Trrap UTSW 5 144,776,523 (GRCm39) splice site probably null
R6288:Trrap UTSW 5 144,748,802 (GRCm39) missense probably damaging 1.00
R6290:Trrap UTSW 5 144,741,828 (GRCm39) missense probably damaging 1.00
R6316:Trrap UTSW 5 144,750,336 (GRCm39) missense probably benign 0.02
R6398:Trrap UTSW 5 144,727,680 (GRCm39) missense possibly damaging 0.83
R6413:Trrap UTSW 5 144,720,856 (GRCm39) missense possibly damaging 0.83
R6499:Trrap UTSW 5 144,793,812 (GRCm39) missense probably damaging 1.00
R6529:Trrap UTSW 5 144,771,014 (GRCm39) missense probably benign 0.06
R6574:Trrap UTSW 5 144,752,360 (GRCm39) critical splice donor site probably null
R6631:Trrap UTSW 5 144,708,460 (GRCm39) missense possibly damaging 0.94
R6727:Trrap UTSW 5 144,793,760 (GRCm39) missense probably damaging 1.00
R6776:Trrap UTSW 5 144,788,066 (GRCm39) nonsense probably null
R6914:Trrap UTSW 5 144,720,853 (GRCm39) missense possibly damaging 0.83
R6942:Trrap UTSW 5 144,720,853 (GRCm39) missense possibly damaging 0.83
R6945:Trrap UTSW 5 144,727,665 (GRCm39) missense possibly damaging 0.66
R7023:Trrap UTSW 5 144,728,964 (GRCm39) missense possibly damaging 0.64
R7107:Trrap UTSW 5 144,733,945 (GRCm39) missense probably benign 0.05
R7139:Trrap UTSW 5 144,739,988 (GRCm39) missense possibly damaging 0.65
R7148:Trrap UTSW 5 144,758,613 (GRCm39) missense possibly damaging 0.77
R7167:Trrap UTSW 5 144,776,424 (GRCm39) missense probably benign 0.39
R7171:Trrap UTSW 5 144,730,859 (GRCm39) missense probably damaging 1.00
R7205:Trrap UTSW 5 144,779,517 (GRCm39) missense possibly damaging 0.94
R7215:Trrap UTSW 5 144,733,945 (GRCm39) missense probably benign 0.05
R7255:Trrap UTSW 5 144,795,764 (GRCm39) missense probably damaging 1.00
R7261:Trrap UTSW 5 144,782,287 (GRCm39) missense possibly damaging 0.67
R7264:Trrap UTSW 5 144,751,333 (GRCm39) missense probably benign 0.05
R7372:Trrap UTSW 5 144,726,208 (GRCm39) missense probably benign
R7447:Trrap UTSW 5 144,776,284 (GRCm39) missense probably damaging 0.97
R7449:Trrap UTSW 5 144,788,019 (GRCm39) missense probably damaging 1.00
R7655:Trrap UTSW 5 144,779,422 (GRCm39) missense probably damaging 1.00
R7656:Trrap UTSW 5 144,779,422 (GRCm39) missense probably damaging 1.00
R7662:Trrap UTSW 5 144,769,321 (GRCm39) missense probably benign 0.00
R7716:Trrap UTSW 5 144,713,956 (GRCm39) missense possibly damaging 0.73
R8143:Trrap UTSW 5 144,772,707 (GRCm39) splice site probably null
R8183:Trrap UTSW 5 144,765,343 (GRCm39) missense probably benign 0.01
R8265:Trrap UTSW 5 144,722,344 (GRCm39) missense possibly damaging 0.53
R8273:Trrap UTSW 5 144,727,975 (GRCm39) missense probably damaging 1.00
R8556:Trrap UTSW 5 144,762,747 (GRCm39) missense probably benign 0.44
R8674:Trrap UTSW 5 144,727,842 (GRCm39) missense probably benign 0.02
R8777:Trrap UTSW 5 144,773,949 (GRCm39) missense probably benign 0.10
R8777-TAIL:Trrap UTSW 5 144,773,949 (GRCm39) missense probably benign 0.10
R8817:Trrap UTSW 5 144,782,348 (GRCm39) missense probably damaging 1.00
R8841:Trrap UTSW 5 144,781,021 (GRCm39) missense probably damaging 1.00
R8871:Trrap UTSW 5 144,758,649 (GRCm39) missense probably benign 0.30
R8937:Trrap UTSW 5 144,757,063 (GRCm39) missense probably damaging 1.00
R8966:Trrap UTSW 5 144,740,162 (GRCm39) missense probably damaging 0.96
R9010:Trrap UTSW 5 144,783,226 (GRCm39) missense probably damaging 1.00
R9095:Trrap UTSW 5 144,733,961 (GRCm39) missense probably damaging 1.00
R9127:Trrap UTSW 5 144,767,830 (GRCm39) missense probably benign 0.16
R9132:Trrap UTSW 5 144,726,362 (GRCm39) missense probably benign 0.03
R9224:Trrap UTSW 5 144,708,049 (GRCm39) missense possibly damaging 0.70
R9338:Trrap UTSW 5 144,727,925 (GRCm39) missense probably benign
R9380:Trrap UTSW 5 144,769,981 (GRCm39) missense probably benign
R9457:Trrap UTSW 5 144,763,478 (GRCm39) missense probably damaging 1.00
R9464:Trrap UTSW 5 144,763,517 (GRCm39) missense probably damaging 0.99
R9504:Trrap UTSW 5 144,742,904 (GRCm39) missense probably damaging 1.00
R9583:Trrap UTSW 5 144,777,330 (GRCm39) missense probably damaging 1.00
R9584:Trrap UTSW 5 144,777,330 (GRCm39) missense probably damaging 1.00
R9585:Trrap UTSW 5 144,777,330 (GRCm39) missense probably damaging 1.00
R9608:Trrap UTSW 5 144,780,128 (GRCm39) missense possibly damaging 0.60
R9728:Trrap UTSW 5 144,726,193 (GRCm39) missense probably benign 0.22
R9782:Trrap UTSW 5 144,758,716 (GRCm39) missense probably damaging 0.99
X0060:Trrap UTSW 5 144,780,171 (GRCm39) missense probably damaging 0.96
Z1088:Trrap UTSW 5 144,771,007 (GRCm39) missense probably benign 0.00
Z1177:Trrap UTSW 5 144,756,518 (GRCm39) missense probably damaging 1.00
Z1177:Trrap UTSW 5 144,747,154 (GRCm39) missense
Z1177:Trrap UTSW 5 144,793,761 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAACTACGCTATGCACATG -3'
(R):5'- TAGGAATAGCGCCCATGTTC -3'

Sequencing Primer
(F):5'- TGCATGACACACAGTGAAACATG -3'
(R):5'- AATAGCGCCCATGTTCCTGAG -3'
Posted On 2022-05-16