Incidental Mutation 'R9404:Sh2b1'
ID 711410
Institutional Source Beutler Lab
Gene Symbol Sh2b1
Ensembl Gene ENSMUSG00000030733
Gene Name SH2B adaptor protein 1
Synonyms Irip, SH2-Bb, SH2-B, Sh2bpsm1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R9404 (G1)
Quality Score 217.468
Status Not validated
Chromosome 7
Chromosomal Location 126466994-126475424 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) TC to TCAGCCACGGGGACCAGCCC at 126467599 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032974] [ENSMUST00000032978] [ENSMUST00000205340] [ENSMUST00000205440] [ENSMUST00000205497] [ENSMUST00000205733] [ENSMUST00000205889] [ENSMUST00000206664]
AlphaFold Q91ZM2
Predicted Effect probably benign
Transcript: ENSMUST00000032974
SMART Domains Protein: ENSMUSP00000032974
Gene: ENSMUSG00000030730

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.39e-16 SMART
Pfam:E1-E2_ATPase 92 340 1.5e-66 PFAM
Pfam:Hydrolase 345 715 7.5e-20 PFAM
Pfam:HAD 348 712 1.2e-18 PFAM
Pfam:Cation_ATPase 418 528 3.2e-23 PFAM
Pfam:Hydrolase_3 683 747 2.3e-7 PFAM
Pfam:Cation_ATPase_C 784 987 4.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032978
SMART Domains Protein: ENSMUSP00000032978
Gene: ENSMUSG00000030733

DomainStartEndE-ValueType
Pfam:Phe_ZIP 25 81 4.6e-25 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 133 151 N/A INTRINSIC
low complexity region 156 168 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
PH 247 378 4.82e-7 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 466 483 N/A INTRINSIC
SH2 525 610 2.84e-23 SMART
low complexity region 668 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205340
Predicted Effect probably benign
Transcript: ENSMUST00000205440
Predicted Effect probably benign
Transcript: ENSMUST00000205497
Predicted Effect probably benign
Transcript: ENSMUST00000205733
Predicted Effect probably benign
Transcript: ENSMUST00000205889
Predicted Effect probably benign
Transcript: ENSMUST00000206664
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SH2-domain containing mediators family. The encoded protein mediates activation of various kinases and may function in cytokine and growth factor receptor signaling and cellular transformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice are infertile. Female mice have small, anovulatory ovaries with reduced numbers of follicles and male mice exhibit small testes and sperm deficits. Mice homozygous for a floxed allele activated in the pancreas exhibit impaired glucose homeostasis when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 T C 4: 106,758,312 K314R possibly damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atad5 T C 11: 80,114,238 V1167A probably damaging Het
Bbs12 T C 3: 37,319,408 S2P probably damaging Het
Cdh11 A T 8: 102,679,622 L73Q probably damaging Het
Cdk15 A G 1: 59,289,755 E274G possibly damaging Het
Col27a1 T C 4: 63,275,941 V845A possibly damaging Het
Cyp3a11 T C 5: 145,862,448 T310A probably benign Het
Efcab5 G A 11: 77,132,108 T593I probably damaging Het
Ewsr1 A G 11: 5,072,940 M388T unknown Het
Fat2 A G 11: 55,253,522 probably null Het
Gm8225 T A 17: 26,543,060 I75N probably damaging Het
Gsap A G 5: 21,269,921 Y526C probably damaging Het
Hk1 T A 10: 62,296,080 I203F possibly damaging Het
Insl5 T C 4: 103,018,338 R72G probably benign Het
Iqcb1 T C 16: 36,851,270 V321A probably damaging Het
Iqcd A C 5: 120,600,536 T140P Het
Kcnt2 T A 1: 140,425,369 I272K probably damaging Het
Klhl25 A C 7: 75,865,405 I20L probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrba T C 3: 86,297,917 V356A probably damaging Het
Mast4 A G 13: 102,751,425 Y1159H probably damaging Het
Mavs T A 2: 131,241,898 L105Q probably damaging Het
Megf6 T A 4: 154,263,768 C902S Het
Mgea5 CTCGGGTC CTC 19: 45,754,657 probably null Het
Mmp17 A G 5: 129,605,677 D460G possibly damaging Het
Myh2 G T 11: 67,179,628 A466S probably damaging Het
Neb T C 2: 52,257,776 N2744D probably damaging Het
Olfr1197 T A 2: 88,729,207 M131L probably benign Het
Olfr169 C T 16: 19,565,981 V301M probably benign Het
Olfr213 T G 6: 116,540,747 I98S probably damaging Het
Olfr446 T C 6: 42,927,816 V195A probably benign Het
Olfr541 T A 7: 140,704,809 L186H probably damaging Het
Olfr972 A T 9: 39,873,412 I46F possibly damaging Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Pax5 G A 4: 44,645,565 P255S possibly damaging Het
Pcdhga2 A G 18: 37,670,014 T304A probably benign Het
Pcsk1 T G 13: 75,132,223 S722R probably benign Het
Pcsk9 C A 4: 106,454,526 R218L probably damaging Het
Pds5a T A 5: 65,618,964 I96F probably damaging Het
Pkdrej C A 15: 85,819,069 V889L probably benign Het
Plekhh2 A T 17: 84,571,040 probably null Het
Pnn A G 12: 59,071,972 E447G probably damaging Het
Ppp2r3a A G 9: 101,148,641 L289P probably damaging Het
Ppp6r2 A G 15: 89,268,550 H298R probably benign Het
Ptpn23 T C 9: 110,386,957 N1277S Het
Pus10 T A 11: 23,711,202 F263L possibly damaging Het
Rexo5 A G 7: 119,801,319 Y109C probably damaging Het
Rnf185 A T 11: 3,432,615 C23* probably null Het
Runx1 T C 16: 92,689,027 N140D probably benign Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Scn9a G A 2: 66,526,696 T1087I probably benign Het
Slc7a11 T C 3: 50,381,039 H350R possibly damaging Het
Spaca6 T C 17: 17,837,538 C155R probably damaging Het
Spire2 C T 8: 123,363,338 R580* probably null Het
Srgap3 A T 6: 112,729,655 M851K probably benign Het
Themis A G 10: 28,789,747 D602G probably benign Het
Tmem56 T C 3: 121,235,082 N52S probably benign Het
Trak2 T C 1: 58,921,137 T236A possibly damaging Het
Trrap T C 5: 144,815,415 C1709R possibly damaging Het
Ttn A T 2: 76,754,156 S22203T probably damaging Het
Ube3a A G 7: 59,287,015 T701A probably damaging Het
Ufl1 T C 4: 25,275,912 I164V probably benign Het
Vcpip1 T C 1: 9,747,631 T176A probably damaging Het
Virma T A 4: 11,513,626 D493E probably benign Het
Vmn2r77 T A 7: 86,802,039 W378R probably benign Het
Vps13b A T 15: 35,876,419 T2799S probably damaging Het
Vps8 T C 16: 21,608,177 S1337P probably benign Het
Zcchc6 A T 13: 59,799,887 N873K probably benign Het
Zfp235 A T 7: 24,140,437 I94F possibly damaging Het
Zfp3 A G 11: 70,772,540 K442E probably damaging Het
Zfp418 A T 7: 7,182,105 I356F possibly damaging Het
Zfp790 G A 7: 29,825,760 G68S probably benign Het
Other mutations in Sh2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Sh2b1 APN 7 126469293 missense probably damaging 0.99
IGL02320:Sh2b1 APN 7 126469169 missense probably benign 0.02
IGL02589:Sh2b1 APN 7 126469268 missense probably benign 0.19
IGL02668:Sh2b1 APN 7 126472474 missense possibly damaging 0.62
IGL03189:Sh2b1 APN 7 126468530 missense possibly damaging 0.61
R0130:Sh2b1 UTSW 7 126471448 missense possibly damaging 0.95
R0532:Sh2b1 UTSW 7 126472272 missense probably benign 0.00
R2081:Sh2b1 UTSW 7 126472690 missense possibly damaging 0.62
R2109:Sh2b1 UTSW 7 126472364 missense possibly damaging 0.74
R2409:Sh2b1 UTSW 7 126471479 missense probably damaging 1.00
R2566:Sh2b1 UTSW 7 126468926 missense probably damaging 0.99
R3752:Sh2b1 UTSW 7 126468787 missense probably damaging 1.00
R4675:Sh2b1 UTSW 7 126471446 missense possibly damaging 0.79
R4970:Sh2b1 UTSW 7 126468803 missense probably damaging 1.00
R5102:Sh2b1 UTSW 7 126471236 missense probably benign
R5912:Sh2b1 UTSW 7 126471470 missense probably damaging 1.00
R7368:Sh2b1 UTSW 7 126468513 missense possibly damaging 0.59
R7694:Sh2b1 UTSW 7 126467757 missense probably benign 0.03
R7801:Sh2b1 UTSW 7 126471292 missense probably benign 0.15
R8005:Sh2b1 UTSW 7 126469307 missense possibly damaging 0.82
R8353:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8356:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8453:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8456:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8456:Sh2b1 UTSW 7 126467600 nonsense probably null
R8683:Sh2b1 UTSW 7 126467571 utr 3 prime probably benign
R8906:Sh2b1 UTSW 7 126471120 critical splice donor site probably null
R8921:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R8922:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9000:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9000:Sh2b1 UTSW 7 126467571 utr 3 prime probably benign
R9269:Sh2b1 UTSW 7 126469182 missense probably damaging 0.99
R9284:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9284:Sh2b1 UTSW 7 126467575 utr 3 prime probably benign
R9284:Sh2b1 UTSW 7 126467592 utr 3 prime probably benign
R9285:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9285:Sh2b1 UTSW 7 126467579 utr 3 prime probably benign
R9285:Sh2b1 UTSW 7 126467593 utr 3 prime probably benign
R9286:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9287:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9287:Sh2b1 UTSW 7 126467578 utr 3 prime probably benign
R9287:Sh2b1 UTSW 7 126467591 utr 3 prime probably benign
R9287:Sh2b1 UTSW 7 126467599 utr 3 prime probably benign
R9398:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9398:Sh2b1 UTSW 7 126467574 utr 3 prime probably benign
R9398:Sh2b1 UTSW 7 126467584 utr 3 prime probably benign
R9399:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9399:Sh2b1 UTSW 7 126467572 utr 3 prime probably benign
R9399:Sh2b1 UTSW 7 126467578 utr 3 prime probably benign
R9399:Sh2b1 UTSW 7 126467590 utr 3 prime probably benign
R9403:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9403:Sh2b1 UTSW 7 126467573 nonsense probably null
R9403:Sh2b1 UTSW 7 126467575 utr 3 prime probably benign
R9404:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9467:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9467:Sh2b1 UTSW 7 126467582 nonsense probably null
R9482:Sh2b1 UTSW 7 126467596 utr 3 prime probably benign
R9495:Sh2b1 UTSW 7 126467572 utr 3 prime probably benign
R9507:Sh2b1 UTSW 7 126467588 utr 3 prime probably benign
R9511:Sh2b1 UTSW 7 126467578 utr 3 prime probably benign
R9514:Sh2b1 UTSW 7 126467578 utr 3 prime probably benign
R9514:Sh2b1 UTSW 7 126467593 utr 3 prime probably benign
R9514:Sh2b1 UTSW 7 126467598 utr 3 prime probably benign
R9624:Sh2b1 UTSW 7 126467570 utr 3 prime probably benign
R9624:Sh2b1 UTSW 7 126467572 utr 3 prime probably benign
R9624:Sh2b1 UTSW 7 126467578 utr 3 prime probably benign
Z1176:Sh2b1 UTSW 7 126467731 missense probably benign 0.23
Z1177:Sh2b1 UTSW 7 126471123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGATTATTAATGGCTCGGGG -3'
(R):5'- ACTTCCTTCCACAAGCAATGTC -3'

Sequencing Primer
(F):5'- AATGGCTCGGGGGTGAC -3'
(R):5'- ACAAGCAATGTCTTCTCACCATTC -3'
Posted On 2022-05-16